Description :
From Genome Similarity Track
Location :
Scaffold_46:128846- 130074
Transcript NameFunction/comments
Phyra_95598conserved unknown protein

Sequence
1228 bases(100 bases per row)
CTCTTCCTCCCTATTGAACGGTGAGGTGGTTCGGAGCATCGGCGAAGTAGGTCTGTAGGATAAACGCGCGTGAGAGCAGCGGCTCGATCTCATTCTCAAC
CCAGTCCTTCGTCGGCAGGCTTTGCAGGAAGAGTACCAAGTCTTGGAACTCGAGCGTCTTGAGCGTCTCGCCAAACGTCATGAGAATGGCAGCGCAAACG
TACACGTGGAAGCCCTCGAAGCCCGAGTCTTCACACAAGTAAGTATCCCAAATGCGTACGATGCCGTCCAGCGGGAGCTCGCGCATGAGCAGGCAGTTCA
TCCAACGGAACGCAAACTGCACGAACTGCACATTCTCACGCTCCACAATGTGCCCAAACAGGTCAGCATCGCAACGGTGCACCAGTTCCTCCATGCGCTG
CACCATGCGCTGCAGGCCCGGTTGAGCAAACGTGTAGTGATCCTGGATATCGTCCAGCAACTTTGTCAAGCACCAGTAGCTGTCTGCCTCCACAATCTGC
AAGTTCTCGTCCGAGATCATCGACAAATCGCACGCCTGCGGCTCATCTGTACATCAAGCATCGCTGTCAGCACCAGCACCTTCATCGCCATGGCCAGTCA
TATGGAGCTCTCGCTCGTTTACCGATAAAAGCCGAAAGAAATACGACTAAAAACGGGGTCATGAGGTCGTTGATTCCCTGCACGTAGCCACTGGCTGGGT
GCCGGATAGCCCATATATATAGGACGCGTTCCATGCACTGCATGCGCAACGAGGTCATCCACATTAGCATGGTATAAGCAACCCAAGCAATGCCACGGTC
GACTCACCTGATGGATGCGCTCGCTTTGGAAGAGCTTAACATCAGCGTTGGTGCGTGGAATGTCGACGAGGATCTGGCGCAGCGTGGTTTGCTCACGCGT
GCCCCGATCAGTGTCCGGGATGTAATAATACTGCTGCAGCAGTTCTACGTATTCCTGTCGCTTTCGCTCCAGCATGGCGGCACGTCGATCTTTCTTCGAC
GGCATGTAGCCCTGCAATCGAGAACAATATCACGGGGTGAGTTCATGGATTCAAGCAAAAACGCACGCATAAGGCACCCGTACCAACAGCAGCCGCCAGA
CTGTAGGCCGATGCTTCGTAGGGACCCCACCCCAACTGAGCTTGCGAAGCTGGTCCAGGTCGATGACTTCCTTCTCTAGCAGTCGCTCGAACTGCATGTA
TCGAAGGTTCCCTGACGCATTCCGAGAC