Description :
From Genome Similarity Track
Location :
Scaffold_224:1288425- 1290617
Transcript NameFunction/comments
Aphin_H310_09590lipoic acid synthetase putative
Aphin_H310_09591DNA replication licensing factor MCM5 putative

Sequence
2192 bases(100 bases per row)
GCTACATCGCGCGCATAATGTACTTGTACTGGTTCATCTGCTTGAGGGAGCCCTTCTGGACCATGCCGCGGATGGCGCGCTGGATTGCATTTGGATTGTG
TCCCTGGCGAAGGTTGAGAGAGGAAGGAGATGCGTGTGGAGCCTGTACCTGCGACTCGAGCTTCGTGTACAGCGCGGTCGTGTCCATGCGCACCCCAACA
TGCACCATCTTCAGAATAGCGTCTTCGACGACGGCTGCTTTTTCGTGGAAGGCGCCAAAGAGACCTTGGGTCCCGCCGTCTTGCGATGCGTTCATCGTCG
AGACCTTGAACAGTCGGATCGCCTCCTCGACGTTCTCTGGGGACACTTCGATCTTCAGATGCATCTTGGCCAGACTCTCCGAGATGCGCACCAACGCTTC
CAGTTGCCGGACTGTGATGGGAATCGCACGCGCTTTCTCATCCTGGCGTACTGTGTCGCGGACCTGAACGTAAAAGTCCTGGAGGGTCTGCGTCGCCTCC
ATGGACAGCCGGGGTGCAATGCGCTGCCGACAGTATGTGATGAAGCGCTTCATGAGGGCCGGCTCAATCTCCTAAGCGTGTTCGTTCACCCATCCGAGTG
CGCGCTGTCACACTATACACACCCCATGCGCGTCCTGCAGCGTCTGGTTGAGCTGGTTCGTGTGGACCCGGACTACATGCGCCGCCATGTTGCGATCGCG
AGTCTCGTCTTGAATGTCGCGCACGATGAAGATCAAGTCAAAGCGACTCAGAATTGTACTCATGAGATCGATGTTGTCGGACGCGCTGCGCATGTCGTCG
TAGCGGCCAAAGACAGGATTCGCCGCCGCCAGCACGGACGCCCTGACGTCCAAACATGAATTGATACGTCAAAGGAAGAAAACATTGTATACCGTGAGTT
GAGAATGGTAGTGATCCCTGCCTTGGCAATGGATATCGTTTGCTGCTCCATGGCTTCGTGGATCGCGACGCGGTCGCTCTCGCGCATTTTGTCAAACTCG
TCAATGCACACGACGCCGCCGTCTGCGAGCACCATCGCGCCACCCTCTAGGAAGAACTCGCCCTTTGCGTCCTTGATGACGGATGCCGTTAGCCCAGCTG
CGGAACTGCCTTTCCCGCTCGTGTACACTCCGACGGGGGCCACCTTTTCAGTGAATTTGAGAAACTGGGACTTGGCGGTGGATGGATCTCCAAGGAGCAA
CACGTTGATGTCACCACGCAGCTATGCTGAATGGTCAGCTACCGGCGGAGAGAACGAGATGCGTACAATCATGCCATCGGGAAGCCGCTTTCGACTACCC
CCGATCAAGAGGCACGCGATGGCTTTCTTGATGTTGACGGTGTAGTCCCCATAGATGCTCGGTGCGATCGAAGCCGACAGTTTCTCGTACAGGTTTGGGT
CGCGCGCCATGTCGGCAAATATTTCTTCTTCTCGTGGGGTAAACACAACTTTGGCGCGGCCTGCACCCTCTTCGTTGATCTGCACGTCGACGGGATGGTG
AATGAGGGGCCATGACATGGACACGTCGTACCTCGATCCCAACGACGCGGAGATAGGGCGTGCGGATGGCCACGGCGCCGACCTGCTTCTTTGCGTTGAA
TACAGACGAGATCCCGAGGACTGAGACGCGGGTGCCGGGGGACGCTTTGTCCACCAAATACCTGCGCCAGGGTTGGAAAACGACAGATTCGTGCAACGTA
CCGGTCGCAAGAGAGAAGCAAGTGGCGCGGCATTTCCCCCGTCGGCACGACTTCCGGACTCTCCTGGAGCTTCAGGGTCTGCTGGTCGACGTACGTGCAC
TTGTCAGGCATGATAACATAAGAGTCCTTCGGACAGTCTTGCTGGAGCACGCCCATGTTGCCTTCCGCGTCGTTTTGTGCGCGGCGATCGCAGTTCCGAG
GGACGGCGACACCCTAATCAAGGAAATACGCTATGATGGCATGGAGGCGGAAAAACGTGCCTGGAATGCACTCGGACAAGCAAGGTGTTTGACATGGCCG
CAGTTCTTGCACTGCACCGTGATGCTCATGCACTTGGCGCGCACTTTCGACGAGCTGATAACAATACCAGGAACCTTGACGAGGCGATTCACCTGGGATG
CGTGAACATCTCGCAGCCGCATGCTTTCCATCGCTGCGCTCTTGAGCACAACCTGAATCGGGTGCGACTGTTGCTGCTGTTTGGCAACTTGT