Description :
From Genome Similarity Track
Location :
Scaffold_170:12884- 15587
Sequence
2703 bases(100 bases per row)
GTACCGCTTAAGACGTGCAACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGTAGGTCGATGGTTTACGACGCACCATGTCTGGCCAGGACTGCAAAT
GGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAATGTCAAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAGCCTCAA
ATATGCTTACGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTTTATCTTTAGCCGCTGCCATGGCATCGCGGACTCTGCTGACAACGCTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTACGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTCTCCTCGAAGAGTGAGATGCACTCTGGGGTGGCGGAAGCCGTTCACGTAGAATGGCGTGAGCCCCGTGGACGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAACTGGAAGCTGCGTCCACCACGTACATGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATATGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGG
TCTCGATCCGAAACAATCGTATCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCATAACAGTGACGGGAACTG
GAGCAAAATGTACCATCTCGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCATGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGACTTCCAACAGTCAGCCGGTACGGGTAGGCTCTGTAGTCGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCTTAACGTAC
CGGGCGACCCACTTGTACATGTGGGTCCACCAGAAAGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCG
CCTCCGCGAGGATATCGAACTTCAGATCCTCATCGTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCCGTAATAGAGGAGACCCTCTTTAAAC
TCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCATAAGGAACTTGACGATAGGCGCGACAGCCTCAT
CGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGGGCCAACTCGTAGTCTGGACGCCGAGAGAGGGCGTCCGCAAG
CACGTTGATCTTGCCCGGCTTGTACTCGACGCGGAAGTTGTACTCCGCGAAGAAGGAAAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAATTTGCC
GCCGTCCTCAAGGATCCGTGGTCTGTGTAGCTCACGAAGGGCCGTGAGCCCAGAAGGTGAGCCCGAAACTGCACAAGGGCATACTTCATTGCCAGGAGCT
CCTTGTCGTGGACAGGGTAGTTCCGTTCGGCGGCTTTGAGCTGCCTGGACTAGAACGAGATAACTCGCTCATGTCCAGCCGTGTCGGCCTGCAGCAATGC
ACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGAACAGGGGCCTCTTGGAGACTGGCCTTGATG
CTGTCAAAACCATCCTGGTGCTCCTGCTCCCAGCGCCAGGCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCTGCGTACCCTGCGCTGT
ACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGATCAGC
CCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATTA
CGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCTTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTAC
GAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAGCGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATG
CCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGTTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCTAGCGCACTGTACAGTACGCTCC
CGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTT
TCCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCTTTCGCTTTCGCGGCGAAGAAGGCATCAATG
ACCTCGCACTGTTCGCGCGGGAGAGGCGATTGTCTCGTGACACAATACTGTGTGCCAGGCACGAGATCAATCTCATGCCGTACACCTTGATTCGGTGGGA
GTT