Description :
From Genome Similarity Track
Location :
Scaffold_405:12882- 15924
Sequence
3042 bases(100 bases per row)
CCATTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGACTTCATCCCACGCATGAAAGCTACTCCCATT
TGAGTCAAAACGAATGGAACGCTGTCGAACGCTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCGTACTGCTGTCCGCCCTGGAGCCAGACGGACAGCA
CGCCACCATCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGCGGGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAAAAGACAGAGCTGTTGAGA
GAACATAATTCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCGACGTATACACGCCGACCCGAGGCTCTAAAGATTGACATCT
CAAAGTACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGGTTCGTGGAACCAGACGATGCCATAAGGGCTCGTCATATCGTCGATGAGGAAATGCAGAT
CGCATTTGCTCAATCGAACTTGGCAGGGCATGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCAAG
TCCCTGCTAAGGCAAACTTTTGAGCCTCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTTAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACA
TTCAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAATAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGT
TAAAAACTACCTGTTCCGATTGGAGTTCAACACCCCAGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGCGAGACAAGCTCACGCGAATTCG
AATTCCTATCGTCCGTCAAGACGACAGGAAAATGGAGGCCCAGAACCAATAGACCTCTGTCACGCGAGGAGGGAGAGCTCTCGTGTTATAAACTACAAGA
AATTGCAAAAATGCAATAGATGTCAGAAGACAGGGCATTATACGTATGAATGCAGTTCCCCGAGCGCGGTACCACATACCGCAGGAAACAATAACCGCCA
AGCGGCCAGACGAGGTCCAAGGCGTGGGTCATCCGACGTTGTTGCGAAAACGCAACAACGTAATGGACAGCCGAAAACGGTCAGGGTCAGTAGGTGCGGA
GCACCCCACTGATCCAGCAACGTCAAGTGAGTTTGCAGGCCTCTTGACGAAGGTTGCTCCCAACACTCATTCATTGTGTGTTGCTGCTTCTGGTAATGAG
GTTTCCCTCATTACCTTGAAACTCGAAGTGACACAAGGCATGTCGCTTCGAGCCCTAGTCGATTGTGGGGTGTCGAACAACTTTGTACGACGCCAATCGC
TAGACAACAGAGAGCTCGAATATATCAAGCGCGAGATCTCTCCAGCGAGGATGACGGTGCGCCTCGAGACAGGCGCATTCGTAACATTGATGAAACGTGT
AGTGGGTATTACCTATACACTGAAGGGAGTCCAATACGATGATGACTTCATCATATTAGACTTCAATGACAAATTTGATTTCATCCTTGGACTGCCGTGG
CTCAGAAGGTACGAGCCACAAGTCTCCTGGCATCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCC
CACAAACATGTGGGTGTACTACGAGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGGCTGATCGCCACAC
CATGAAGCCAGATTCCGGCGACTGCATTGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTTTAGTGGACTGGGCATGAGTGTCCTCCAAACG
GACAACGCTCAAGTGACAACGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGTGAATCGCACGTAGAAGATCTGGCCGCGGTAGA
ACAATCAGCCAGAGGATAACGAGGGAGCAATTCCACTCGTGTCATATGATATTATCGCCCAAGAGGCTAGTGAGGGAATAAGTCCCTACCCAACTGTGGA
AATAAGTTCCCAGGAGACAACAGAGACATTAAATGTCATAGTCAATGACGGATCAAGTATAGAAACTTACCAACTTGATCTGATCGCGCCTCCGAAGACA
ACTTCGGAGATCATTCAATTGCCCACGCTCGAACAAAAAAGGTTTTTGCGTGATCTGCGCATGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAA
GACGAGAACGTAACCGATATTCGGTCGGCAATGGTATTCGCTGAGAATGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTAATGAGAAGA
CTCGGATCGCGGGAACCGCTCAAGACAAATCCTCTCTACGATGATTTGACGAAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAGGTACCCGAGG
ATAAGGGTACTCGTCACGAGATCGACCTGAAATCAGGGTCAAAGTACTAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGCGA
TTGAAAAATTCTTTGCCGGTCGCTTGGCAGTGGGCCATGTGAGGGAAGGGAATCTACTTCCCCATATAGCTCTCCGACCTTCTGTGTACGAAAGGCCACA
AGAGGGTGGCGTATAGTACATGCCTTCAACAAGTTGATTGCTGTTACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGT
CAAAAAGTACCATCTTTTCGTCCATGGATCGGATGGATGGCTTCTGTCAGATCCTAATGCGTGAAAAGGACATTCCTTATACAGTAGTGAGCACCCCAAG
CGGTATGCTGTGGGAGTGGCTAGCAATACCACAAGGGATGAGTAATAATGCCCCTGCTACGTTCAACAGATGCATTACGAACTGTTGAGATCCGTGCGAG
AATGCGCACCTAGCTATTTCGATGACGTGTTCGTCCATAGCC