Description :
From Genome Similarity Track
Location :
contig_16:128814- 130159
Transcript NameFunction/comments
g4211.t1AAV92918.1 pol protein [Phytophthora infestans

Sequence
1345 bases(100 bases per row)
GCGTCGACAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAGCCAGCGGGCCATCCTCTGAGACAAATGCG
GAGAGTTGGTGGCCATCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATAGGAGCT
CCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGTCTGGACTGGAACGAGATGACTCGCTCGTGCCCGTCCGCGTCGTGTTGCAGCAGCGC
GCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGATG
CTGTTGAATGCATCCTGGTGACGGCTCTCCCAGCGCCAGTCGCCATCCTTCTTAAGGAGATCCGACAGGGGTCGTGCCAGCCCGGCATACCCCGCACTAT
ACTTGTGCAAGTAGTTGGCGAGGCCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTGGGCCAGGCCGCAATAGCCTTGACCTTCTCAGGGTCGGC
TGGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCATG
ACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGTACGTCTGCG
TGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGAGCATTTGATAGACCCTGTGGCATCACTAGCCACTCCCAGAGCAT
GCCGCTCCGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAG
CCCGCCATGTTGTTCAACAACACATCCTTGCGGGAGATGGGTGTCTGGGCGGGAACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACT
TCCCGTTCGGCTTGCGAACGCAGATGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAAT
GACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCCTAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGA
GTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCA