Description :
From Genome Similarity Track
Location :
Scaffold_556:12881- 14381
Sequence
1500 bases(100 bases per row)
TCTTGGCTCGTAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCTTCATAGCCCACCCACTTGACTTTGAACTC
GCGTACAGCACGCTCCGTGCTCGTCGACAGGGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCT
TCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTACCAACCGAGTGTTCGGTCGACTGTTGAACTCGTTAACAGCTTTGA
GTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGG
TACATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGA
GCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTTCAGTCGACTCA
GGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCG
CCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGCCGACTGCGCATCCCAACCATGAACGAGGTAGAAC
GGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCATCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACA
CCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTC
TGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACT
TGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGACCCTACGAG
ATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTACCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTT
ACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCGGCGTACAAGCCGATCCAATAATAATTGGACTTAACGCGGTGGAACGTTCTCACC
ACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTATTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCC