Description :
From Genome Similarity Track
Location :
contig_16:128799- 130144
Transcript NameFunction/comments
g4407.t1POM69526.1 Pol protein [Phytophthora palmivora var. palmivora

Sequence
1345 bases(100 bases per row)
GCGTCGACAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAGCCAGCGGGCCATCCTCTGAGACAAATGCG
GAGAGTTGGTGGCCATCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATAGGAGCT
CCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGTCTGGACTGGAACGAGATGACTCGCTCGTGCCCGTCCGCGTCGTGTTGCAGCAGCGC
GCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGATG
CTGTTGAATGCATCCTGGTGACGGCTCTCCCAGCGCCAGTCGCCATCCTTCTTAAGGAGATCCGACAGGGGTCGTGCCAGCCCGGCATACCCCGCACTAT
ACTTGTGCAAGTAGTTGGCGAGGCCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTGGGCCAGGCCGCAATAGCCTTGACCTTCTCAGGGTCGGC
TGGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCATG
ACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGTACGTCTGCG
TGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGAGCATTTGATAGACCCTGTGGCATCACTAGCCACTCCCAGAGCAT
GCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAG
CCCGCCATGTTGTTCAACAACACATCCTTGCGGGAGATGGGTGTCTGGGCGGGAACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACT
TCCCGTTCGGCTTGCGAACGCAGATGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAAT
GACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCCTAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGA
GTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCA