Description :
From Genome Similarity Track
Location :
contig_4:128790- 134815
Transcript NameFunction/comments
g1070.t1hypothetical protein, variant 2
g1071.t1hypothetical protein PHMEG_0006078

Sequence
6025 bases(100 bases per row)
CGTGCCATCAAGGCGCTGTCACTCCGTGGGCATCATCAGTCGAGTGTGGAGGGGGAACAAGGGCGCAGGCAGGCAGCGCAGGCAGCGATCCAGGCAGCGT
GTCCGCCCGTCGTTGCCACGTTCAGTTTGGTCCTCCCAGATTGTGCTCGTAATTTGGTCAGGATTTGTGTCCATAATGTGTACGGGCGATCGTTATGGCG
CGATGTCAACGTTGGTCTGTATTTGTGTCAGGCCGATCGTTATGTCGATCTCACCCATGGCAAGTGCGCCAGACGAGCACGTCGTGACGGCCGAGGACCT
CCTGGAAGGGCCCAGAGCGAAGCAGTGGGTGCAGGTGGCCGCGCGAGTGTTTCCCGAGCTGGACACCATCTCCAAGGCCAAGCGCGCTCGAAAAGCGGGG
CATTTGCTACTTAACGAGAAGGAGATAATGTCTGTTTTGAGTTAACTGACAGCTACACCGCACGCGGCAGCTCAATGAACGCAAGGAAATGCATTTTTCA
CCCCAGCACCACTGGCATTGGCCACCTGGAGGCTGTCGGCGGCTCGACGTGGTTGACGAGACGTTGGATGAGGCCGTCGAGATTCCAGCTCGAGAAAAAG
AGGCGCCCGCAGGGTATCCTTGACCTGGAATCCGCGATTGCGTTGGGTACGACTGGTGCATGTAGTTGCCGCCACCGCTGCTGCCGCTTCGAGTACTGCT
GGCCGTACCCAGTCGCTGGTAGTCAACGCCAGGAGTTGGTGGCGGCTGTTGCTGCTGTGCGTGCTGGTGCATGAATTTCGAGAGTGGAGACGGAGGGTTG
ATACTGTCATCAAACGCTCCTCCGGCAGGCCCACTGCTCCAAGTTGATGAGGAGGTGGTCGGACGGTCGCCGTAGTTGCTGCCGTTGCTGCTGTTCTTGC
GCGCTAACCAGAGTCGTCGCTTCTTTTCCCAGTTCTGGTCTCGCTTGGAGGACGTGAGCGGCGGTTGGGAGCCCCAGGAGCTTGAGCTCGAGCTCGAGCG
GATGCTCGACCGAGAGCTCGGTGTGGGTGACGAAGAGCGGCCGACTTGGCACCCGTTGGTGGTGTACCCAGAGCTGTTGCCGTAATTGTAGCCGTTTTGG
TTGCTGGCAGTGTGTGCGGTCTGGTACTGGTATGGTTGCTGTTGCTGGTACATTTGCTGCGAAGAAGTGAAATTGTTATATGGGACTGGGTCGGATTGCT
GCATAGAGGAGTAACTCGGATAGCCATTGCCCGGTGCGTTGCCATTGTTATTGCTGAAGCTGGTCGTCGAAGGAGTATAGCGACCGCTATTCGGACGTGT
GTATGCGGGCTCCTCCTTGCTGGGCGCTTCTTCTGCCGGCTCTGCTGTGCCGAGTCCACCACAACCTGAGATACGACGCGAGTTAGTCAAGCGTTTGGAA
CCTGAGGCACGTACGCACTCACCGAAGGAGAGACTGGAGGCACCACCAGGTGGTGCGTGAAGGCGTGTGGAGCTACGTTTGACGTGCAATTGTGCGGATG
TGAGCGTCGACATGGTTCAGGCAGTACTCGGTTGTGTTGCCTGGCTTCTTCTTCTTACTGGACTGGATGGTTGGATGAGCGCGCGGGGAGTTCTGCTTCT
CGATTTACTCGGGAGCGCAGGCATCATATTTATATCGCAGTGCCTTGCGCTGGGGAAGCAAGCGCCCAAGAATAGGCAGTCAAGGCGAGTTGGAGGGTTG
GGAGATGCGATCTGCAGCGCTTGCACAAGTTTTTGCTTCTCAAGTTCCTGCTCGCCATAGCTATGGCGAGTCTGTTTGACATCGCTGCAGATTTAAGTCA
GTATAATGACGACTGTGGAGACCCTGCCAAAGCGAAGTTGCAGGCAGTGCATCCTCAGTCCGCGCTTGGCATTTTGGACGAGACATTTGAGACCATCTAC
GGCGCACGGCAGTATCGATCAGCCACCCGGCATATCCCTTTAATACGATCGACAAGTATGATTCAGCTCCAGCCAACTCGACTTGCCGAGGCGAAGAGCT
CTGAAGCGTTGGATGCACGTCTTAATCGGCTGACAAGTTTGAAGTCTTCAGTGACAGCTGCGAGACGAGTGACCGCTGCAATGGCCGTTGCAAGCTTGAT
CATTCCACCTCCGCCAGCGGTGCCTCCTCCTGATAACCCCCGCAAGAAGAGCAGTGTCGGCAAAGACCCCGATGTCACTGCAAAGGCTGTACTGTGCGAA
GTCACAAACGAAATTGACCAGCTGATGGCGACAGATACCAGCTCCGCTGAAGAAGGTGAATCTCTACTTCGTATGCTCTCAGACAAGTACATCAACACGC
GATTGGTACGGACGCGCATATAAAAGGAAGGAGTGATGGCTGGTGAGGCTACTGACATTGATGTAACGTGTTCTATGTTGTCCACAGAGTAAGCTGCCCG
GGACACCGTTCGTATTGCTAGTGCGCAAGAAGGTTGCGCAAAGGCTTCAGCAACTCGAGGATCACTTAGCGCTCGAAAAACTATTGACAAACACGTGGAA
AGCAGCAGCGGCAATAACAACGACCCATCAGCCACCGGTTCCGATAGCTGGAAGACACTGCAAAAGTTGGCGCCAGCTCAACACGAAATGCTACAGAATC
TGCTCCGTTTGCCTGAGAAACAGCTACTGAAGCTACCAAAGGCCCAGCTTGAGCTCGTGCAGTTCGCCAAGCGATATGACAAGCTCATCAAGGCTACACC
CGACCAGCTTCGCCATCTGCCGATTGAGCACCAGCAGCTTGTTCGAAGCATGCAGCAGCAGCAGCAAAAACATGTTCCTCGCACTGACGAATGCAGTTAA
TATGGAAATTAACGCTTAGCTAAAACTTCGTCAGACCCTACAAGCATGTAAAAAGTAAAAAGTAATATCTGTGAAGCCACATTTCGTTCATTTCTGTCAG
TTGTCTTGGCCAGCCGGGTGCGAATGAAAGCTGCTGGTAGCAACAAGCACGAGCTTGTGCTTCGCGACAAATCCAGCAACATCAAAATTCGAGCGTTTTT
CAGTTAGGTCGTCATCCGGCGCATCGGGAGCACTTCCTTCCTGGCGGAAAAGCAGCGAGACGTAGCGGTGTTCCCCCGGGTGGTGTCACCGGGTAGTACG
GCACTACTACTACGTTTTGCGGCTGGTCTTGAACACTCTGCCCGTCCACAGCTAGGCCCGCCAAGATGTAGTGCAGGAACGGCGCGTGCGTCGGAGACTT
GGGATCCGGAGCATCAATGTCGATCAGCACGTACGTGTAGCGCCCAGCACTGCCAGCTGGGCTGCCTTCAATAGAGACACTCGGTGCTTCTTGAGCCTAG
CAGTCAAGACGAGCATGATGTGAGACTTGCACTTCGTCCAACGGATTAAAAGGTAAAAGATCTGGTGGTGCCAACCTCCTTCATGGGCACAAATTGCCCC
AGGGTCACGGGGTGGCCGCCATTGAACGCGATAGCGATATGGGCACTGCTCCCGTCCTGGATTTGGAGCTGCAGCTGCTGCAGAACTTGCACGGGGACAG
AGTCGGTGTCCATTTCGGCTGCGAGGCGAGCGTCGTCACAGATCCGTCCTCATTTCGGAGCTGGTGGGAGGCAACCCCACGGACTGCATGACAGCCCCAT
CAGCGCCATACTCACGAGAAAAGCGGTCGCGACGAGGACACCCGCCCCGCGCAGCGAGAACGAGGCAGGTGCCAAGAGCGGCGGCGGGAGCTTGGAGCCG
TACGACATCTTTTGAAGAGCTAACCGGAAATGCGCGTGCGACCGTTAGTTTTACCTGAGTTGAGTATGTTTTGTGTCGAGACCACCTCAAGTGCATTATT
TTTGCTTACGTCTACGCTACTATTAGTTAATTGACAGCCTCGTGCTTTCTGGCCCGGGCGTCGATGACCGCAAGCCATCGCTGTGTGGCCATTGTGCGGG
GCGTGCTTTTTTGAGTGCGTCGCTGGCGTTTCTCGACGAATGCGTTGGCAGCGAGACGGCTTTCGGGGGACATGATGTCGTCCCAAGCACGTGTCCGCCC
GGTGGCTTTTGCAGGCGGCTCGATGATCTCCATGTCCAGAGCAGGTGGAGAGTGTCGCTCCGGCTCATGCACGCTCTGCGTGACATAGATCTCTTCCGGC
TCCGTCTTGTGCGGCGAAGGAAGTGCTGCGACAGAGTAATTTCTTGTGTTGTCGTTGCCCGTCTGGTTGGAGTGACTGCGGTGCTCATAAGGACGGCGAG
CAGGGTCATCGAGAACAGGATAGTCAAGGTGATCGGCATGCCGTGTCGGGGAGGGCTCTCTTACTTCATAAGCAGCTTGGTTGTCGTAGTCATGATCACG
GTCCTTCCAGGTGTAGCGTTGGCGTTGGAAGTCATCCCGGCGGTGCATCTGGTGCGGTGAGCTGCTTGGTGTTGTCAATCTGGGAGATGGCAAAATACTC
TTAGATTCTCGGCTGTGACGCATGTAGTCAGCGTTGTAGTCAAAGTCTTGCTTTCGATACCCTCGCGACGCCGAAGAGTGTGTGGGGCTCGGAGCAGCAC
GAATGGGGCTTCTGCTCATGGAACTAGATTTGCTCGGCGCTGCGGTATACTCGGAGCGATGCCAAGGGGAGACAGCGCGATTTTGACTCGGGTGTTTGCT
GACGTAGCCTCCTCGAGACGGTGTTCATAATGCGGTTTGTTGCTGTTCACGGACGCGTTGGTGGCTGTGGTGGCGTCGCCGAGTGTACTGTGTTGCTGCT
GCTCAGGACGCGGAGGCAGGCCGTATGCGTCCAGTTCGCGACATTGCTCGCGCGGGTAGCGAGAATAGCGCTGCCGGTTGCGATCACCGTGGCTACTACT
GCCGGGTCCGTACGAAGTTGAGGGAGGGTAGTATCGGTCGTCTTGCTGCGATGGGACAAGGTACGCTGACGGATCGATGTGCGTGTGCAGGCGCACAGGG
TAAGTGGGCTGCGTTGGGTTACTGCGCCGCGTGATAGGTCCACGGGAGCTCGAGCTCACGAGGACGTCTTCATCGTCGCCGCGACTGCTGATATCGTACG
CGGTAACCTCCACGGGCTGTCGAAGCAGGCGATCCGAGTCGCACGCGTATTCGTCGTCCAAGTCGTAATCTGGGCCTTGGCGTACCATCTTAGCCCGTAG
CCGCTCTTGGATCAGGGCCTTCAGAGGGGTTGACATACTGCGAGCTCTCTCGCGATGAACGGCACTTTAAGTCGCAGAGGACTGGATCGACGATGGCCGG
GAAGAAAGGGAATGAAGCTCCAGTCACTGTGGGGTTCTCCTGCTTGTGCGCTCTCTGGGTTGCCGAGCTGGGATTGTGCGTGGCCAGCAGAACTATATGT
GGCGCCGACAGAGTCTGTGGGCCATTTTGGGCGGGCGGTTTTCGGTTTTCAGGCTGCGAATAGCCCTCATCCAGCTTTTTATGGCCCTGTAAACGTTTCT
TGTCATAGTCATTTCTGCTGGCGTTGCCCCGCACCAAGACAGCGATCAGATTGGCACGCTCGCCGACTAATTAACTGACGGCCGAGGCTGTTTCACAGTT
CGTATGATGCCTATGTTTCGCGCCGTTCTTAGTTGGTTTCTCCTTCTTGGAATGAAAATGTATGTGACTATTCCAGGCCGAAAGTTAAACACCGAGGGTC
ACCGGCGTCCTCGTGGTGTGTGCTCCAGGCCGAAACGTGAGTCGATTCTAAATCAACAGTCTGTAAAATGGTGATTGATACCCGGGCGCTATTTAAGCTC
CCATTCTCCGATGTCAGGCGTGTACAACAAAGGCAGAAACACGATACGTTGGCTATTATTCTCATGTGATGAACTTTCGTGTGTTCACAAAGTGTAGAAA
AAGTGTAAAGCTCTAGCGAGGGAGCTGGCCTTGCCCCGAGGAATTCTTGTCGTGATGTATGGGAAAGTCTGTCCGTGGGTCTGCTTCTTAGCTGCGTGCT
CAATCCTATGTTCTTTCCTCTTCAAAGCACTTCAACATCACTGACCAATTATAGTAGAGCCGCCTTTGGCCTGTTGAGGACAATGCGGGCGGAGCCTTGT
CGGCATTTAAGAGGAGAATGGCTCA