Description :
From Genome Similarity Track
Location :
Scaffold_896:12879- 14626
Transcript NameFunction/comments
Phyta_totarag11233hypothetical protein PHYSODRAFT_414520

Sequence
1747 bases(100 bases per row)
TTTGCGCGGCACCGTGAACGATTGAAGAGATTGAATCGCGTAAAAAAAACCCGCAGTCTAAAGCGTTCATGTCTGGACTCTGTGTACTACGAGCATGACT
GGCCGATTAGCCACGCCTTGGACATCACGATTTGTGATTCACGAATGATGCTGGTATGTTCCACGACCTCATTATGTAGGGCTAAATGACGGACCTAGCA
CGCACGGCGCTAAATAAAGCAGTCTTCAACCAAGCAAACGTGCCGATGAAGGACGGCAACTTCCTCTCGATGACCGAAAAGGCCAGGCCGTTCTAAATTT
CACCAAGCTCAGCTAGTTGAACTCAACTGTTTATGgtactgttgctgcagtacaaGGGTGAAAGGTAGTATTGCAGAGCATTTGCATAATTCAACACCAA
ACCATGCACAATTATTGTCCACGGATGACACGTCCACTTTCACATTTACTACCCACACTCTGATATCCCGGTGCAGTCGAGATCGCTAGAACGGCCAGGC
CTTTTCAATTTTCGGGAGGAAGTTGCCGTCATTCATCGGTGTGTTGGCCTTACCGAAGCGCGCCTCGTTCAACCCTCTACGAGCCAGGTCCGACATTTAG
CTCCACATAATGAGGTCTTGGAATCCAGTGGGAGTAGACGTAACGTCCAGCGCGTGATTAATCGGCCAGTTGTGCTCGTAGTTAACCTTAACGCTGATGC
CGTCGACGGCATTGGCAGGACGTTAAGCATACTTCTTGTAGCCGTCGTGAGACGACGCTGACACCCCCAGGATCTTCGGCTCCGGAACTTCCGGGTTGTC
GATCCACACCACAACGTGCTCTCAGTCGTGGCGGTGACCCAGGCCCGTGGACGGTGAGTCCTTGAGGAAGTACCACGAGTACATGATGGCCCAGACACCC
TTGAACCAAGTGGAGCGGCCGTAGATCTGCGAACCATGACCAGAGCCTCGACATCCGCCCTTGGGGTTGCCGGACTCCTGGAGACCACCACTGGTCTCGC
CGATATCGTTCACAGCGGGGTATGGGACGCAACCGGAGCCGATGTGCAGCTGAGGTTTGAACTTGACGCCAGCCCTTTCGGAGATCGTGACGGGCTCAGG
TTGAGCGTAAGGCTTCACTTCTTGGTGGGAGATCGTTTTAACCTGCCACTGGTCTTGCTGGGTGCTGTCCTGGGCCTGAGCAGCGGTGAGAGAGAGGATG
ATAATATCGAAGAACGCACGGAGCTTCATCTGAATTGTTCGTTCTGGGGGCCGGAGGAGTTTTGTTTGTCCGGAGGGGGAAATGGAGAAGTGAGCACTCG
AATTCGCAGCTCGACTGCAAATGATCAGTTTGACCATTATTAATCGTCACGTTAGTCTCCGGTCCCATCGCAGACGGTATCACTTGTGGCGTTAGGCGCA
GTGCGTGTTTCCCTTTCGCATGTTGGCTCGAGATGTCCACTGTACCATTATTAATAGGACGAAGTTGTAGTGCGAATCCCGTTGCTATGTAATTTCCTGA
CAGGAACTGCGATCCAGGAACGCCTACAGGTCGTTTTATCGCGCTGAAAACTAATGCGTGAGTGATTGGCACCGCTTAATGACCTCAACTTGAAGATCGT
ATTATTATCCACGATCGCCTACGTGATCCTATGTCAAACATCCGGTCGAATTAATGGTTGTTGTTGGGCAAAGACAAAACTAAGCTACTGTACTCAAACC
TTGAGCCTGCTACGGCATGCACCCTTGTCCCGTGCCCACAATACTGT