Description :
From Genome Similarity Track
Location :
Scaffold_70:128760- 129894
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17499pectin lyase

Sequence
1134 bases(100 bases per row)
AACGTGCCAACGCCGAAGTTATCAGCCGATTCTGATAGCTGAGTAGCCTCACCCGGTTTGTATCCCGTGATCTCCTTGTACTTCTTCACCGTCTCTAGAG
CTCGCGCTCCGTTCACCGACTCAAACTTGCCACTCTTCTCTACAGTGTTGCCAGGACACGAACGACCCAGTGCAGCACTGCAATCGTCCGCCACCGAGAT
GCTCGCTTTCTCAGCGTCGGCCTCCATGGGCTGTAACGTACCCTCAAAGAAGTTGCCTTCAGCCAGAACGAAAGCGTTCTTCCCTGGCTCAAACGAATGA
CCCGAGTTGTCGGACCAGTAGTTGTTGGCAATGTGCGCCACCACGTTTGCATTCGGACTTGACGCACCGATGATTTTTGGTGAACGGCCCGATGTCGAGT
GGACGTAGTTCTGGAGGAAGCTCACGCGCGTAGTAGTGCCGTCCAGAATGAACCCCCAGTAGTGACGACCGTCACACGAACTCGACCAGTCTGTGCGGCC
ATCGAAGTCCGAGTTACTGATCGTGATACTCTCGACACCGTCAAAACCACTGACGAACATCTGCCGTCCAACACGTGACACCTTAACGTGGTCGATCCAG
ATTTTCTTCAATGCGCGTTTATCGATGCCTCCCATGAAGAAGGCATCTCCTCCCCAAATATACTGCGGGTTGAGCTCAGTGATGTGGATATTCTGGATGA
TGATGTTGTCACCCTCGAGCTTGAGTCCTTTGCCTTTCAATACCCCTTTCTTGCCGACACCACGCAGTGTCTTGTTACTGCGAACCGACAACATGTCCTT
GCTGGCGTTGTCATACGTGATCTCCACTTTCTCTGGCTGATCACACCCTCCTGTGTGGGTGAGCGTGGTGTCACCTGGAAAGAGAATCACATCCTGACCC
TTGAACCCGTTGCTCTTGGCGAGGCAGGCCGTGTTGGACTTGGGTCGGCATCCCATTTCGGTCGTTTTTCCTTCGGATCCGAGGAAGTTGAATTCTTTGT
CAAGCACGACAACGCGCGGCTTATCATCGCGGAGGAGCTCTTTTAGTTCGTCCAGCGTTTTGGGGTGGTCGGGTATTGCGTTTCCTCCACCGGTGGTGCC
GACAGCGAAACCCGGAGCTTCTCCGGTGGTGAAG