Description :
From Genome Similarity Track
Location :
Scaffold_381:12875- 25209
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_381-fgenesh-gene-0.4Dynein heavy chain

Sequence
12334 bases(100 bases per row)
GCAGCGTCGCCAAGAAGACGTAGGTGGGGCCGCGCTGCGTGGTCTGGAACACGGGACAGTCGTACACGTCCGGTCGGCGCCGGAAAAACCCAACGGCCGT
CGCCTCCCACTTGTCGTCCACCACGACCGCGCGCGCGTACACGACGGGAAGTGCGGGGAGCAGCTCCTTCGGCCTCGAGTCGGCCAGCTGACCACCGCAT
GTCACGCCATCGATCTCGTACTCGGGTGCGATGGTTGTCGACGCGGCAGTGTCGCCGTTCCCAGTCTCCCATCGCGCGCCGTCGACAAACAGCCCGTGCA
CAAACGCCCCCATCTCTGGATGCGTCTCGGCGGCGTCTGGCGTCGCCAGCAGTGTCACGTGCGTCTCGATGGCCATCGCGTCTAGCGGCAATCCGTGCCG
CCGCGCCGTGCACTGCTTGACGGCCGTGAGGAACGCTGTCGGGTTGAACAATCCCGCGAGCCAGACCGAGTACGGCAGCTGCAGCTCGCGCATCCAGTTG
GACAAGAAGCTCGCGCGCTCCAGCAGGTCGGCGAACCACGGCGCCAGCGCCTTGCGCGACGGCCACGCGGCCTTGTCCCAGTCGGCGCACTGCGCGAGCA
CGCTGCGGCCGGGTACTTCTCCTCGAATCAGGGCCGCCGACAAGTCTTCGAGCGCCTCCGTCATGCTGAGCGTGCCCGCGAGTCCCTTGGCCAGTTCGCT
GAGGCTCGAATGGATCTCGCGCACCAGTCGACCTAGCCTCGTGGCTTCCTGCAGCGCCACCACCACGTACGGCGACTGGTCAGTCGTCAGTAGCGGCTCG
GCACGTGCAATCAGAGCCGGGAGGTCTGGCTCGGAAGGTAGGCGGTCCAGCAGACTCTCGACCACGTTCAGCACTCGCGCGTTCTCCTTGGGCATTGCCG
GCGCCGATGATGATGATGATGACGGAGCGGTCGCAAGTGGCTGGAAGGCGCCAATGAGCGCGAACACGCGGTCGGCTGCGTCGAGGAGGAAGCCCACCTC
GGCGTTCGGGTGGAGACCGTACACGCGCGGCGACTCTGTCGGTAGCGCCGCGTCGATGTGCGCTGCGTACTTGCTGTACGTGCTTGACAACGGGTCCAAA
CTGGTGAAGCCCTCGGCCAGCGCCGTCTTGCCTGCGACTACCTCCGGCGTGAAGACAGCCTCGAGGTACGTGCGGTTGGTGATGCGGTCCCAGTGATCGG
TGATGTGGCCGCCGTACATGATCTCGCCGAAGATGAAGCGCAGATCGTCCCACGGCAGCGTCTTGGATCCGCCGCTGGCAGTGGTCGAGTTGTCGATGTA
CCTGCGGAGGATGTCGGCGCAGATGAGCAAGTCGCCCATGCTGAAGCTGTACCCGCGGCTCCAACCCTGCGCACCGAACCGGCGGCGACCGAGCACGAGC
GCGTGGAAGAAGCAGAGCGCGAAGAGACAACCCTGGAACTCGCTCGGCTGTGCGCACGCCTCGATCTGCTTGAGCGAGAAGGTGGCCCACGCGCGCTTGA
GATTGCTCTTCAGATCGGCTGGAGCCTCGTTCGCCACCTTGATGCAGCTCTGCAGCAGCGACTCGGGAAGGTTGGACAGTGTCGCGAGCGCTGGACCTTC
AGCCGAGAGGAAGCAGCGGAAGTTCTGGTCGGCCGAGACGGAGCACAGCTCGAGAGTTCGCTCGAGCTTGGGCAGCCAAGACGGCATGAGGTGGATATTC
TGCAGCAGCACCCAGTTGCCTTCGCGAGAAAACTGGAGGAGCGTGCTGTCGGCCACAGCTTCCTGTCCTTGACCCATCGACAGGTTGGCGAGGTTGCCGC
GCTCGGTCGAGTAGTCGAACTTCTGTCCAAGCGCCTCGACCCACGCTGTTGGGTCCACACCGGGGAAGAGAACGAAGAACATCGGCGTAGACGCGCTCGT
CTCCTGGTACGTCGCATCCATGTCAAATGGAGGCTGTTGCACCATAGCAGATCCAAAGTGCAGCACGAGGAACGCCTTGAGTGCCGCGAGCATGCGGTCC
GGACGCAGGACGCGGACCAGGTGCAGCACTTGGACAGGAGTTACCGAAGTTTTGTATGGCCCTGGCATCGGCCGCGATTCCGGAAAGTCCGAGTCGCACC
ACTCCTTCCACTCTTCGCAGTCCGACCGCAGGAATGTCGTGAGCTTTTGCAGGCTTGGAATGACCACTTCGAGTCGACACACCCGCAGCCACGTCGATTC
GCTCATCCATTCGCTCAGGAGACCCATACTGGGTATCGATTCGCCGCTGTCGTCCCCTGTCCCCGCTGTCGGTATGTGGACGAGCTGGAATACGTCGGCA
GACGTCATCTTGCCCTCGCTCTGCAGGATCGCAAAGCCCAATTGCGTGGCGAGAGTCAGCTTGTCCTTCTCGAGCATCCCGCGACGAATGTAGTTGAAGA
CGACGTCGGTGATGGACGTCTTGAGTTGATCGCACCGGGATTCGATCTGCTCATCCGTCGGCATGCCTTCCTTGTCGGCCTCCGCCATGAGTTCACCCAA
ATCTTGGCCTGTGTCGCCTCCCAAGGCATCTGGGTCTACCACGCGATCAGCAAGCAGCAAGTCGGCATTCCACTGGAACCGCTGGGTCGCAATAACCTTC
TTCGCTGCGGCCTTGAGCCGACCGAGAAGACCTCCAGACTGTGGACGGTCCCCTCCACCGCTGTCGGTCGCGACAAGATCGATTCCACGCTGGAAGATGA
CAACAAAGGCGTTCAGCGAGTAGACGTAGTAGGCGTGCATGCGGTGCAGCTCGTTCATGAGGAAGAAGAGCAGTGCGCCACGACTTGCCACCGACAGGTA
CTTGACGCTCAAGTCGTTGATCTGCGCCTCGTACTCTTTGGCTCGCGCTGCTTTCTCTGCGATCTCGATAGCAGCAGTCTTCGTAGTCTCGAGGTCGGTG
ATGAGCTGCACGTTCTCGGTGATGTCGCCCTCGGCCTCGGCGAGATTGCTCAAAATGCGGTCTTCTAGCGCTTGGAGACGGATCTTGAACTCGTTCTGTT
GGTGCAGGAGTGCCGTGCGGATCTTGGCGCGCTTGGGCCACTCCTTGCGCACGACTAGCGCAAGCAACTGGTCTTCGAGTCCCTGCTGCGTCACAGCGAA
ATTGACGACGGTCGTCTCGGCCTGCACTTCGGGGGGATAGTGCGGGTTCGACATCTTCGTGTGGAGATATAGTCGGAAGTCGGGATGCAGCTCCACGAGC
TTGTCGCCCATCTTGAGTAGCGTCTTGCGACCGCGCACTGTCGTCGACTTGGCCACGACCGGCCAGAGTGCCACCTCGAGCTTCTCTCCCATGTTCTCGA
CGATCACCGAGTGACCGTTCTCGACGGCCAGTCCTAAAATCTCCGACAGGTTTTGCTGATCCTGTCGCACTAGAACGAGCGATGTTGGGGCCGTTCGTCT
TGTGTACTTCTCCATCTCGCGCAGCCAGTATATCCCCTGGAGCTGCGGGTCAATCAGTAGCGGACATCTAGCGCTACGGCGAACGATCGCGCCGTTCTCG
ACCGACACGCGATCGCTCGGAAGCCCTCTCGTGTTCCATTCAGCTATCTCAGAGGACGTCGCAAGGTGGATAAGCGGATTCAACTCGTCAAATAGCGCTG
GAGAGTCGTCTGTTTTCGCAGCCACTCCGCCTGGTTTGTTGGAAGCCGTCAACGCCTTCCTGAGGAACGGAACCCACTTGTCGGTCATGAGCGTGTCGCG
ATACGGCTTCGTGAAGGCTCCAGCGAACGAAGCAAAACTCGCAGCCAGCAGCGTCTCGTACGAGAGCATGTCTGCAGTCGAGCGTAGTCGGTCCAGCTCC
TCTGACCACCGCTGGCTCTCGCTCCCGAGTGCATCGGCTAATCGTCTCGCGAGCGACATGCGCAGTCGACCACGTTCCACCAGCGCAATCGCATCTTCGA
CTTCCTTGTTCGTCCGGTCGAACTCCTCTGTCAATGTGGAAAGGCGCTGCTCGAGTGTCGCCACCTTCTCGTTGACAGCGTCGAGCTTCTCGTTCGCGAC
GCGCATCTTCTCGTTGGCTTCGGCGAGCGCCTTCTTCTTCGGCTCGACGACCACGATCGCATCGTAGTACGCGACAATGTTGATGACCCACGCGCACAGA
CCTGCAGCCGCTGAGTTCTTCTTCTCGATCGTCTCCACGTTGAAGTGCTCGAGCGCCAGGAACGGTCGCACTTCCTTCCAGTTGATGTCAGGCACGACAT
GGTCGTCCACAAGCGCCTTGAAGCCTTTGAGCTCCTCGACAAACACGTTGATGTTCCCCAGAAGCGCTTTCTTCGTGGCTTCCCACGACCGATCCTTGTC
CTTCACCTTGCCGTTCTTTTGGATGATCACGTTCGGGTTCACACCAGCAAAGAGCACAACCACAGCGCCAAACACATCCCCAACGCCGGCAGGAGGCTTC
GTCATAGTCTTACAGCTACCGAGATCCTTCTTGTTAAGGGTATCCAGCGCTGCCATTGCAGCCTCGACCATAGGCTGCGCCTGGGCCAGATCCTTCTCAG
TGTCTTCCTTCTTGGCCGTCACATCCGCTTGGATGACAGCGCACTTCTCCTTCTCTGCTGTAGCCTTCGCCGTCTCATTCTCGACGATCTCCTTTTCCTT
TTGAAGTCGCTCAGCAAGCTCCTCGACCACCACGCGTTTCTTCTCGGCCTCCTCGAGCGTGGTCTTCAGCTCGTCCTCCATGTTGGCCACAATGTTGCTC
GTGCTATCCATCTTTTCCAACCCGCTCTGCAGCCGTGCAATTGCTCGCTCGTGGTTCTGACGCTTTTCAGCGAGAAGACTGCCGTAGAAAGTAAGGCACT
CGAGGTACGTACGAGGCGTCGAGTAGACGAAGCGCTTCTCGTTCGCCAAAAAGTCTCGCGCCACGTCGTTCGCGCTTTGAAACGCGAATGGGAGAAAACT
CGAGACTGCCGCAATCTCGAGCTCGGTGCGCTGCCAATTCGAATTTTCCTCATCCTCCTTGGCGAGAAACCGTGCAGCTACAGAGTGGAGCGCATCTTTC
GGCCACGGCTGGAACCAATCGATCAGCGTACAGTTGACGAGTGCGGGGAACTTGCGAGCTCGCGTTCGGAAATCTGCAGTCGCCGGCGAGAAGCAGAGCA
CGACATGCAGATTCCGCTTGATCTCGCTAATGAACCACTGCCAGCACCGCTCCTTTTCGCTGCCTTCGCTTCCTCCACTGCTCGCTACCCCACTGTTCGC
CATGGCCGCATTCATCTTCGGCTGCACTTGCTGGATAATGCTCGTCTGCTCATCGGCAGTGTACAAGTCTGGCACGTTCCCGCTCGAAAGCAGGTCATTG
AGCAGCACGAGCATGCGTTCGTTCTTGATCTGACCGTCATTGAACAAGAAGACAACGCCGTCTCCCTTGATACCGGCTTTGGCAAACATGTTTTGAAGAT
CCGTTTTGAAATCCATCAGCGAGTACGCCTGTGTGAGTGCGATCTCGACGAGAGCGTACCCGCACATGAACGCGCTCAACCGAGCCAGCGACTTTCTCCC
GCTGCCGCCGACGCCAACAAGCAACGCATGGCCAGATGGGTTGGAGATGATCCGCACAATGCGAGCGATATGCTCGAGTGCATCTTTGAAGAGCACAAGC
TCCATCTTGGGGAGCGATTCGTTGTACTCGACCAAGGCTTCTTCGCACGTGGCGAGCAGAGACTGCATCGATATGACTTGGTCGTACTCATTAGCATGAA
GTCCACTCGCGAAATGGCAGAAGAGAATGGGGTCAGCCTCGCTGTTTTCTCCACCGGAGCTTGTTGAGTGTGACGACGGCGCCACGAAGAAGCGTGTGAA
ATTGAGTGATGGAAAGCACTTCCGCGCGAGCTGCTGAACGGCCGAGGTGAATTTGATCAAATCACTAGCCGACACCAGCCGGTCTCCATACACACGGGTG
GACTCGTGCACCCAGAGCAACGCAAATTTCAGAGGATCCTCAAACGTTGCTGGCTTGGCCATGAGCAATCCCTGAAACACGTTGGCCACATGTCGAATGT
TGAACTCGTAGTGAAAGTTGGCGGCAGTCTTGCGAAATGTGGTCGCAGTCTGGGCATGCAACGCCAGCGCTGCCTTGAGGACTTGAGAGGACATTTTGCG
GATATCCTCGACAAAATCAGCCACATACCCCTCCAAGAACGTCGAGTATATCACCTGAAGGCTCGCTGCACCAAGTGTTGCGAGTGCGAACGTGACGAAG
TGCCGTTGGAGCCGAGGGTTAACAGTGAAACTGCCCGCGCTTGGGTTCATGCATGCAAGAAACTGCACGTTCACTATTTGCTTCACGGTATACTTGGCGC
GATCGTACCAATGACCGTAGTCGAGATACTGGCGAAGAAGAGCGATAGCGCTCTGCGTTCCGTATGGGTCGACTTGCGGGAGGTTCAGGTCGTCAAGAAA
ATAGACGAGCTGGTTGCCCACACTCGGCCCAAATGTGCTGCCAACTCGTTTGGACAACTTCGCCTCGAGGATTGACTGCAGAGCTGACGCGTTTGTGTAG
TAGTTGAAGTTGACATTGACACTGGAGAGTGCAGAATCTGCTCCGCCACCTCCACTTTGCCGCGGCTCCATATTCTGCAGCAATCCCTGCACCATTTGGG
TCTTCCCAGTTCCCGCTCCTCCACACAGCATGAACGGTCGCTGCTCGCGCACCATCAGCGTCATCCAGCTCGTGATGGAAGCTGTCTCTGGTGTGGGTAC
AGTAATGGAGGACATGGGAACGGACCCGTCGAACTGAATGACTTTGAAATAGGGCGAAGCGCGCCACGACTCGAAATTCAGCGTATTCGGGTTCAGCCAA
TAGTCAAAGACGGTATCTCGGGTGGGGAACTTGATGTGCTTGAACTCGCCACGCCACCATTCGCTGAAGATTTTTCGAAAGTCCGTGCCGTCGTCCGCGG
TAGTCAATGATGCGCCAAATGCCCATACCGAGATAAAGCCGCTCAAAGTGTCAATCTTGCGAGGGTCAGATAGTGTCTCTCCGTCTAGCACACTATCCAG
AAAATACAAGTACGTTTGCACGAGGCTGATCTCTTGCTGCGGCACTATCGACTTGCATTGCTGCTTCACAAACGCGAGGATAGGGTGGATATACTTGGTC
ATGGCTTCCCCCAGTGCTGTCCGTTGCTGTGCTGACGTGCCCTTAGTTGCGACCCAGCTCGCAAGCAACGACTTCCACTGAAAGCCGTCACTGTCCGAGA
TGTACAGGATTCCTGCGCGAGACACGGTTGCTGGCGTCGCATATTTCAAGTCGCGGATCTCGAATACAAGCCGCATATTCGGCTTGAGCGGAATGCGCTC
GTTGGATGCGAGGGTTAGCATCTTGTTGTCGTCCATGACTGAGTTCATCGACTCGATCCAGTTCGCATCCAGATCGCCATCCAATATGATCCACTTTGGT
CGAGTATCGGTCAGCGATGCTGTCGCAATGTCGCGCATCAACTTCGATAGCAGACCGTCCTTCCACTCGCGAGTTCCAAGCACCATGTAGCCGTACAAAT
CCTCCGTGGAAACTGCTTTGGGGTTGAGGTCGATCGCTTTCGTGACGTAGTCGTCCCCTTTCTTCTTTCGAGCGTTCACCAACACTTCGCAGCAATCTGA
CTTGCCGCTGCCAGGTGGCCCCATCACGAACACACAGTGTCTAATCGCCAGCAATTCTTCCAGCTGGATCACCTTGAGACGGAACTGTTCGTGCGGCCAG
AGCCCCATCTCTTCGCACGCCACCTGGACGAATTTCTCCATTGCCTCATCGACTTTGCGCGGTGGGTTGATCTCTGGGAACAAGTCGCTCAGCAGACCAT
TGAAGACGAGCAAGTCCTGCTCAACAATCTTCGGCAGGTTGAAGTCACGAAGCGAGCGCATTAGGATTTCCTGCTCGGACAGCTTCGGCTCGGCGCGTTT
GAACTGACCAGCGACAACCAAGACGCTCTTGACCGCTCGTAGACCCCAGTCGTAATGGTCCTGTCTCGACAAGAGCTCTTTCAGCAGCGAATACAAGCTG
AAGAATTTGGAGGCTAGCACTTTTGCCTCTCGGAAACCCTCGGCCATGAGCATGTTCTCGCAAATGAGAACCAGGTCTGGCGCCATGACAGTGATGGGCC
GAAATAGAGACTTGAGTCCTTCAGGCAGCTCCGACCGTCCAAGATATCCAGGGTTCATAGTGATGAACGTTCCGCACGTCGGATCCAGTTTGACCTTGTC
GCCCTCCACTACGACCGTATCGCTTTCGCTTCGAATGCCATCGCAAACTGCTTTGAATTGAACCGAGCACACCGACAAGACTTCAGGAATGAGGCGGTTG
AACTCGTCAAAGCATCCCCATGCGCCAGCGCTCGCGAGGCCTTTGAAGATGTTCCCCAGATTCTTGTAGTCCATTTCAGGCGAGCAGTTGAACACGTAGC
AAATCTTTGCGAGCATGTTGGCGAGGTCTTTGGTTGTTTCAGTTTTTCCGGTTCCAGCGGGACCAGCCGGTGCGCATCCCATCTGCATATGCAGTGCCTG
AGTGGCGGTGACGTAAATTCTATCAGTTAACGGCGTGATCACCAGACGTGGCCCATTCCCCAGGTACTCAAACCCATAGTCGAATTGAGCATCGCAAATC
TCCAGGTAAACCTTGTTCTGGCGCTCCGAACGACGCTGCTTCATCTGGGATTGCCACAGAAACGAGCTCGCAGACGTGATCTCCTCGTACAGCAATTTGT
GCACCACATCTCGCGAGTGTGCGTCCATCGTGATCAAACACATTGTGCGCTGTCGGTCATCCTTGGACAGCACATTCTGAGTGAGTTTGATGAGATCACC
CAGCTGGATCATCATCTTGTCCAGCAGCTCTTTCATCGCCGTTGCACGACCTTTCGTTAACAGTTGAAATGCGTTCTCCACTTCGTTGGCGAATTCGATG
CCTGAAACCAGCAACGCGATCTGTGCTGCGTCCATATTGGATGGTGAATTGTCCTTTGGATTCGCCAATGGCAGCTTTTGTAGAAGCCAGTCGGCTCGGT
TCTGCTCAGGAAAGCGGCGAATCGAACGCGCCACTTGTTCTTTTAGCGTGCGCTGCATTGCATCCAGAACGACTTGCAGATATGATTCGACCTTTCCAGC
CAGCATCACACTTGGTTCGAACGCGACGCGCTCGCGTGCCGTATCGTTGGATACAAAGTGAGTCGCTAGAGCGTTGGTGGCGCCACCTCCTTTCTCGAGA
ACCAGTGTGCGAGTGGCGAGAAACACCTTTTCAAAATGACCGAGGATGCTTTGTGGATCGTTTCCTCTTGACAACAAATCCAGCAGATCGGCTTCTGACA
CAAAGTAAAAGCGCGGGAACAGTCTGCGCTTGGAGTCCAAGAACTCTTTCAACGCCTGTTGGCACGCTTCTAGACCGGTTCGCAACTCAGAGAGTTGCTG
GTGGATAGAGGGCAGTTGGCAAGCCGCAATGACATTCCCATTAGGCTTCTGATTCCACATTTGCTGGAGGACAAGCCGAACTCGATCGTCGATCTTTCCG
AAGCGGGCAGCTTCGTTCGGAAGCTCGCGCTTGACCTCTTCAGATTGGATGAACAGGGGCTCCAAATATGACCACGACCGCTGGATCTCGTTCAAAACAG
CAGTCACATCCGACACGAGCATCAACTTCGATCTCCACGCGAGCGTTTGATCATGGAAGAAGTTGTTGCGGCCTGTCGTCATGGCCTGCACGAGCAGTTG
GTCGGATTCCAGCACCTCGACGACTTCTTCTGTCAAGCTCAGGAGCGGAATATCTGTGTCTTTGTAATACGCCATGGAGAACACAATGTTCTTCCATCGA
TTGTCGAGCTCTTGCAGCGTCGCTTCCTGCTTTGCTTCTTTTTGCGCGCGGTCCGTGATCTCCTCCACATCGCGCTGAAACTCGTGCAAATTCAGAGCAA
GAATGTCTGCAAACCGCATCTGCGGGTTATCTTCCGGACAGTCGAACGTCTTCCCTGTCACCTTGATCAGATCTTGCCAGTGTCGCTTTCGCATTGAGGG
ATGGCGAAGGGCTTGGAAGAGAGGACACGTGCTCAAAAACGCCTTCACCACGCGCTCAAACTGTTTGAATGCGTCATACTCTCGAACTTCTTTGTTGACC
GCCTTGACGAGACTCAGAAATGCCTTAGCCTCTTCCTCCAACACAATGCCGTCGACCATATTCCACGGAATCTCTCGAGACAGATCGATTTTCCTTGTCA
CCTCGGAGATGGATTCCCACAGTTGGCTAGCATGTGACAACAGACGCTGGATCCCGCCAAGGACAACCCCGCAAGGACTCATCAGCCCTTCGCACTCGAG
GATCTCGGCAACGTGTCGCTTCTGGTCGTAGAGCGTCTGATCTTGCTCCAAGATTGCCTTCTCCGCCGCCACAGCTTCCAATGCCTGCCGGGCACCGATC
GAATAGTTCCAAAACGGTTTCTGCCGCATCTTCGCCTCTTTTGCGTGCAAAGTCTCCAGGTACGGATCAACTTCGCCGCGAAACTTCAATCCTTGTGCAG
CGATTAGCGGGGTGATGCGAGCGCTGGCAGCTGGAATCTTCTTCAGAATCTCGTGCCACGAGTACTCGATCGACTGAAGCAACTCAAGCTCCTTGGTGAC
GGTGATTCCAGCCTCCTTCAGAAACGCGATTTCAGCTCGCAGTTCCTCGATCGAGGTCGTGATCTCTTGCCCGCGCCTCTCAACCAAGAACACGTGTTCT
TTGAAAGTAATCAAAGCCGCAGTAGTTTGGTCCGGAGACCATGCAGCATCGGATAAGGGTTGCTCCAGTCCGATATTGCAGTCTCGGCAAGACTGCTGCA
ATGTTTGCAGGTCGTTCAAAAGCTGGTCGAGTACCAGCTTCCCTGTCATCAAGTTCATCTCACGCGTCACCGTATCGTCGAACGAAGCTGAGTAAGGTGA
TCCGTGAATCGGACCCGCCTCGCCCCCGAATGTTCCTGCGAACTCCACGTGCACTTTGTACTCCCCGGCGCTTTGCACGCTGTAGCTGACAAGATATTTG
CCGTTCGCCAGATCTTGAACTTGCAGCGAAGGGAGAAACAGCGGCCCTGATTCATCAGATACAATCTCGATCGAGAACTCGTCGTCTCCCCGCGTGCGCA
GCCCTCTTTGAGCATCACAGGCTTGGATAATAAAACACGTTGGCTCTCCGCTCGCGCCTCCCGTGAGCACTCCAGGTCCATACGCGAAACACAGCGGAGC
GTACGTAACCGAGAAGAAGCTGAAAAGTTGAAACGTCGTCGTGAACGAATCGCCCTGGAGAGCCACTCGAATTTGAACGTCTCCTGCTGGGTACGCTGTG
AAGTCCGGTGTCAGAACGTTTAAAGTGTGGTCGTTCACGTACTCGCCGGCCACGTCGACGGATCCTTTGCGGCATGCAAACCGAACAACAACTGGCTTAT
TCCGGAAATCGATACCCTCGATCACCAACGGTGTGCCACCTGTCAGCGGACCGTAATCGGGGAACACGCGCGTGATTCCATACGGAGGTCCGACGACACT
GCTGACGTCGAGCGTGTAGAGATCATTCAGCCAAACATTGGACCACCCTCCGAACACGAACAGGCGACTGCCCTTGTCGTCGTAGGCAAGTGTCGTATCG
CTGCGGCCACTTGGCGGGGTGCCACCAATCTCAGGCGTGCTCCACGTCATCTCCCCAGAATCCAACACGCAAATGTCGTTCATGAACGTTCCCTGTGCGT
TGTAATTGTTGGCTTCACCGAGAACGCCGCCGAACACAAAGATCTTGGCGTGCGGTATCGCCAGCACCGCACAGGAAGCGTGGTTCCAGCGCGGAAGCGG
ACTCGCCATGTGCGTTCCGTCAATGCTGCTCCAGGAGCTTGTCACCGAGTCGAACACGTGCAGGTCGTTGAACTGCGTGACGCTATTCCAGCCGCCACAA
ACTAGCATCTGATCGTCAACCGCGCAGGCTTGATGTCCCGCGCGCTTCTCGGGAGCCTTGCCTTTGCAAGTCACTTTGCTCCAACTGAAATCGTCCAGCC
GCAGTGCATGGAGGTCATCGAAGTCGCGACGACCGTATCCAGATCCTCCATACCCTCCAAACACGTAGATGTTGCGCCGAATCGCCACCGCCGAGTGAGC
TCCACGCGGCGCTGGACAGACCGGAGCCATCCGCGTCCCCGCTGCGGTCTGGGAACCAGCCGACGAACCTCCGGCGCTGTTCCCAGGCTGCGACCAGTCC
ATGGTGATGGGGTTGAAGACCCACAGGTCGTTGAAGCGCACGCTGCTGCTGTGGAAGCCGCCGAAAACGTAGATCTTGTTGTCCACGACGGTGGCCGAGT
GCTTCCAGCGCGGCGGCGGGATCGCGCCTTCACT