Description :
From Genome Similarity Track
Location :
Scaffold_17:128721- 131408
Transcript NameFunction/comments
Hyaar_Emoy2803052hypothetical protein

Sequence
2687 bases(100 bases per row)
GCTTTACGATCAAACGTATCAGTGTGAGGTGGGTCAACACACCCCTTGTCAGGAATAGAATCCATCATTTATAAGTCTGAGCACAGACTGCTCTTTTGAT
CGGCCCTCCAATCGCTTTCCAAGCATTCATAATGATCCATCTCGCCCGCAGTCGCAATCGAGGACACTGATGAGGTCGACCAGGTCGTTCGTGCAGTTGG
CGTCGTCATGTCTTCCTTGCCGCATCTCATTGCGGGCAATCAAAGATGCAGCGCCGACCATTTATCTACAGCAGAGTTGGCGTTAACGAGGCAGCTGGGG
CGAGCGCGTCTTGGCAAGCTTCAACTCGATGCATAACTTTGGTCAGAAGTATTGCGTTGCGCATCCACCATTTGGTCAAAAAGTGAGTCCTCGACCTGCT
GGTATTGTTGACCATCCTGTTCACTGTATTCACGGTCAATGTCTCCTTGTCCATCGTCCCCGGTGTTCCACCGAGTAGTGACAGCTGCGGCTTTTAATCG
GACAGCAAGACTAGACACATTTGACTCGATAGAAACGTCGGACATAACATCGCGTTCGAGACGTCGAGATTGCCGATTCACAGGTAGTGGACAAATATCA
GCCTCAACGGTCTCACTTCGTTCGATCGGTCCAGTCTCTGTGTGCCGTCGTACGCGTGATGAATCAGCTGACGCATTCAAACTCTCGGCGTCTTGTCCGC
AGACGGAAGAAGTCGAGGAATTCCATCCACTGGATAGCACAAAATCCCTTTCATCAACGAAAGTCGATGCATGTTCACCAGTTGTTTTCCGAATTCCACT
CGTAAATGCTTGACGACGTGAATGTTCAGTCGCAGCAGCCTGGTGCCCATAGTAGCTTAGACGTTGTCTACTTTTTCGTCCCGGGGACACAAGCTGCTCA
GCTGTCGATCTTCCGCTATTTTGTGCTTCGATCAGCTGATCTGCAAACTCCTCTGACCCTTCGTTACCCTCTTCGGATGAGTGCGAAACCGACGGCGACA
CGCACATAGGAAAGAACGGGACCAGTTCATTTACGAAGCTATCATCAGCGGGGTGACCAGGTTGCACTTGATCCAAGCTTTCATCAAGTAAGCTTTGTGC
ATCTGAAAGTGGTAACGAGTACTGGGTGACAGACGCAGCTGAAGTACTATGCCTCCGTGCTTCATGGTACATGTCTCGGTGATGCGAGTGGTGAAGATAG
AAAGCCACAAAAGAGTGCCCACTGTCGCTATCGAGAGGAGGACAACACGATTCAGTCTCAGAGTTTCCCTCATTCGTACTAAGGTCTTCAGACTCCGAGA
AGATCGTCATGTGTGGATCTGCAAAGCGATGACCCAGCGTCCTTGCCCTTCCATTTGCCACTTCAGATAGTCGCGACAACGATATTTGGCTGACAGTACC
AGACGATACGGACGATAACAGCTTCCATTCTACGTCCATGGCCACATGATCCGAGTACCTCGCCCTGTCATTAACCATTTCATCGAGTCGCGATAACGAT
TTCTGGCTGACAGAACCAGATAATGCAGACAATGACAACTGCCCTTCTGCATCAAAGCTTTTTCCATCAAACTCGGTACCCTGATCGCAAACTTTCTTTC
CATACGAACTTCTCGATTTAGAGATAGCTGACCGATATTTGTCATGCTCAGCAACAGATGCATGGTCAGCTTCTTTGCAGGAAATGTTCCTTGAAGTCAT
ACTTTTGTTTTCAGCAGAATGCATGGACGAGAAAACTCTACTGTGCTCCATTCTGCATCGAGGCGCTTTTTCGTCTCCTTCGCTCCTTGCTAAATGCTGC
GGTGAGACACCCGGATCATTGGATGTAGAGTGGGTTGCGGCTAACCTTGACGTGGGTAAATTTTCAGGTCGCTGTCTTGCCTTGTCGACATTATTTCGAT
ACATTTCGATATCAGGCGAATGTCGATCACTTCTAGTCACGAGCTCACTCCATTGTGCATCAGGCATCTCCAGGAACGATCGATCACGAATGTCATAGTG
TTTTCCCGATTGCCCTGTATTCAACCGCAGCATTTTCTTGTGATCCTTGGAGGGAGCGACGGAAGACGCAAGGCCGTAGCGCTTTGCAGCCTCTTTTTCT
AAGCGTTCGGTCTCCACAAGTCTGTCCAATCTGTCCTCTCTCTCCTTACCTTTGAGCCTTCCATTTTCTTTAGAAATGGAGCAGCATGGGCACTGTTTCG
TGCAAGGTGCTAAGTCTTGATGATCTCTTACTAGCTTATACCTCTGCAACTGTTGTGTCTTAATCAACCCGTTACTACCATGTATACTGCAGCCCCTACT
CACTTTTGTCTTCAAGATATCAGCCTTGTTCTTCAATTCGCTGTCTCGATACCCATCAAGCGGTTCTAAAGGTACATTGGAAGTTTCTAGTGCATCTATG
TCACGTCTGTCTATCGACGTCACAAGTTTCTCAGTTTCTTCACATTGCAAGCTTTCCAATGTAGTCGTTATCAAGTCCCTTTCACATGCGGGGCTAGATC
GTTCATCATGTCCACTTGTGGCCAAAACGCCAGACTTCATCTCGCCATTCATGTCAATAGAGATGCTGTGCTCAGGAGCTTCAAGCTTACCGCTGCCTCT
TGACTCACCATCTACGATCATATCGCCATTCGAACGCTTGTTTTTGGAATTAGCTAAAGTGACAGATTGAGTATCGTCCGCATCACC