Description :
From Genome Similarity Track
Location :
Scaffold_74:12872- 14397
Transcript NameFunction/comments
Phymu_g3504hypothetical protein

Sequence
1525 bases(100 bases per row)
CGCCTTGAGTTTCCGGTGTGAAACGAACACACCGAGAGCTGTGGTCGCAGTCGTGAAGGCGGTggccgctgcagccacaatGATCCAAGCCGTTGGGCTT
AAGCCTACAAAGACCTTGTCGCCGCCGCTGTCGATGCTAGTCGCTGCCTGCGCACCGGCTTTCGCGCCAGTGGGAATGACGGGGAACACGTTCAAGCCGC
AGTTGACCTTCGAATCCGCTATCAACTTCATGAAGCCGCTGTCGCCCCAGGAACTACCGTACGAGTTCTTTAGGATCCAGTAGTCTCCGACGGACGAATC
CGTACCGTAGCCCACGAGCAGAATCGCGTGATTCAGATCGTTCTTCGACGACAAAACGCCGTTGTTCGGACAAGAGTAAAAGCCGCCAGCGTATGAACTG
AAGCCGCCGTTCGAAGTGATAGCAACTGCAATGGGCTGTTGCTCCAGTGCTGAGCGCAGTAACAACGTGCAAttgctggacgtggagcagTCCGTACCCA
CGATCTGTTCCCAACCAGAGATGCTCGCTGCCGAGTTATTTGAATTACTCGAGCACACGGACGAGGTGTTCGACGCCGATGAACTTCCAGAACTCGAGTC
GTCGTATGGCATCGTGAGCTCCGTGACAAGCCCCCAGCCATTCTGAGCAGCGTCTTGGAAAGCTGCGTGTGTCATGCCTCCGTTGCAACCACTGTTCTGT
GACTCCCACTTGATCTCCGACTGCATCCAAGTAGCTCCATCCACTCCGCTGTCCGAGGCCCAGCAATActcgaacgtcttcgtcatctccagcGTACTAC
AGGTGAGGAATTGCTGTGGTGACAAAGCTACGGCGGCTGACGCGTTCTCTGCAATGACCACGGCAGTCTcgatggcgtctgcagcagcgaacgaCCAACA
GCTTCCACAACTCTTTTGACTCTTCACGGACGAGCACGCGCTGTGGCCCAATGAGTTCTCTGCGTCGCACCAGTTCCAGTATGTGCTGCCCGAAGAACTA
GAGTTTgtcgcttcggcttccagACGGCGAGAGCGGTCGGAGAGTACTTCCTGGTCCACAAACTCCTCCGGTCGAAGCTTTTGGTTCAAGGGCACAGTCA
AGTGCCGTTCGTTCACTCCCATGTGATAGGAAAACTCGTGACCGAGTGTCTTCGCGTATTTGTTCACCGCTACAGCAAGACCACAGGTAAGTTAGTATCC
TGTTCACGCACACATCAAACCAGAGCTTCGTTTTGACACCTTCGATGTACGTCATGTGTGTCTGCAGGTTGCGTCTGTATGCTTCCTCGTTGCTCGTGCC
AACATCGTTCAACTGGATAAAAAGTTCACGCATCGCGTGGGAATCAACCACATCACCGTTCTCGCCTGCCCAAAGGCACGCAGATTCCTCCGAAGGACAT
CCCACGAGGGTGCCTAGGGATCGATCTGTGGTCCTGGCACCGTGAGCGGCGCCCATGACTCCTACGGCCGCAGCGAACGCCACAGCAGCTTGCAACATCT
CGAATCCGCTTGAGCTGGCAAATAT