Description :
From Genome Similarity Track
Location :
Scaffold_408:1287- 2638
Transcript NameFunction/comments
Phyke_g9257hypothetical protein PHYSODRAFT_502841
Phyke_g9258hypothetical protein PHYSODRAFT_502841

Sequence
1351 bases(100 bases per row)
ATCTTGCCCGTGCCAATTACACCCACGGTCTTGCCGTTCACGTCGAATCCTAACAAGCCCGTGAGTCGGAAGTTCTGTTCGCGAGTGCGGTTAAAGGCAC
GGTGGGTCTTACGGTTCAGCGTCATCAtaagagcagcagcgtgctcagcaacagcaaacgGGGAATATGCTGGCACGCGCACGACTGGCATACCCAGCTC
CTTGGCCGCTTGCAGGTCGACCATATCGAAGCCAGCGCAACGTAGAAATAGCACGCGAGTGCCTCGGTCGTACAGCTGCAGAGGCACAAAATCCAGAGCA
TCAGATACTGTGCAACACACACCCAATAGAGCAAACAACTTCGTACTCTGCGCAATGTCACGGCATCTGCCACGTCGTTCACGAAGATGCAAACACCTTC
GCAGTTCTCCGCCAATTGCGTCGTCTGCTGCATCAGTcggttggagaagaagctgtagAATAGGATGCGTATAGCGTCAGTGCTTTGTTTACATGTAGAA
CAACTTGTCAAATACGCGTAGTGGTACTCACACGAGTTCATTGTCTTTGGTCACGCCTGCGTTCTCTGCCAGTGTCTTCAATGCACCGATCTCGTAGTTG
TGCGCCGAGAAAAAGCCGATGCGCATGCCCTTGTGCGGGCTCGTGCCGAAGTTGCGCTGGGTGAGTGCCGGCAGCCAGTGGCGTGTGGTGGAAATCGACT
GACGCCGAGCAAATGTGGTGAGACGTTGCATCATGATACTTGATGTGGACGGGATTCTTTCTGTTTGCTAATGTgacgcagatgctggaggcgctTAGTG
TCACATCGTTTATGTGTGTTGTATCAGTGTAGCGTGTCTTTAGATCGGAGCACTCATCTTGACGTTCTCGGAGCACTCATCTTGAAGTGCCCAGAGCACT
AAGGAAGGAGGTATCCGTACAGGTATTAGAGCGTATTAACAAAACCACAATATGCACTGCGTGATatgctgctgtggtgtgGCCTTACTTCAACGGGAAT
ATTTAACAGCAAAAACTTTTTTAGTTATGACAACAGCCTCATTTACTGTTAGCTCCCGGACTCGCATTTGTGAGTCCTTACAATGAAATACTAGTAACAG
CAGAGAAATCGTATCGTCTGAATCACAAACGGCTTCGAGATAGACCTTACTTGACCTCGttgaccagctcttcctTCGCCACATATGCCTTGATGTTGTT
CATGGTAGTGTGGCCAATGTTGTCCAAAGCCTCTTTTGTAAAGAACGCTTGGTGACCCGTGATGATCACATTCGGGAACGTGAACAAGCGGGCCAGTGTC
TCGTCGGCAATGATGGCTCCCGAACGGTCCGAGTAGAAGTAGTCACCCTCA