Description :
From Genome Similarity Track
Location :
contig_84:128696- 131217
Sequence
2521 bases(100 bases per row)
TGGCTCCGTCACTGTCGACCAATTCGCTGCTGTCCCCGCGTTATCATGTGCAACCGAAAAGCTGCAAGGCCAGACGTGTCACGATGGAATTGTGGTAACG
CCACTCAAACGCCATCACGGAGCTCCAAAACAAACTCTGTACGTGGCTCTTTCACGAGCGGTGAGCTTGAATGGCCTCACTCTCACCGAAAAAATCACAT
GAGAATATCTAGACAGCTTCAAGCCGAATGATGCGACCGTGCTCGAAATACAGCGCCTCATCCAGCTTGTCATTTTGCCGCCATATGCATCTGCAGCAAA
CCACAGTGAATTTAGTCAGTGGTAAGGAAAACAACATGCGTAGATGCAACATTAAAAAAAATCCAGTTTTTTGTCTTCTTTCTTCCTGTTATGGGTGACC
ATACCATAGCATCATACGTTCCCATCAGCGCTCATTACAGCCGTGGGCAACATGACAGCAAACCGTGACAACATGTCTCCACGTAGTCCCTGACAGCACA
CACGCAAGAGGTGAGTATAATCCTAGGTCACCAAGAGGCTAGACTTTGACGTTCTACCTTCCCCGCTGCGACTCCTTGAGTGAGCGATCTTTTGACTGTG
TCTAATCGCTGAAAAAACATACCGTATGCTATTTGGCTGTTCGTAGCTGAAAGACCTCGTGTAGTAAGGTGGCCTTCTATTTGATGTTTATGTGTTTTTC
CCTATAGAAGCCTTATAATATGCAAGACGTGACTTGATGTCTGTCGTCTGTCGAGGAGGGGTTTGTCATTTTTGATCTTGAGTCGTGAATCGGCTGAGGT
AGGCGTGTAGCAGGTCTTGTGCGACTTGAGAGTTGTGTAGAGTGAAATGTCGTGTCTGTTTGGTATTTGCGAGTATGCGTACGGCTTCCAGACTTGCTTT
CGCTGGAGTGCTCCATTGGACTGTGAAGAACTGATGGAGTGTCTGATCCAGTACTTGGACTTCATTGCTGTCGTTGACTTCGTTGCTTTCGCTTGTTGTT
TCCGATACATTGTTGATAGCTTTTTGCGCTGTTTTGTCCACGCTCGCAAGTCGTAGGTATGTCTCTGCTGCTCTGCCGTGGTGTTCCACTGCTTGTAGTC
CATGTGCCAATACGTGTACTGCATTCGCCTGCCGTGACCCCCTTGTCGAAAAGCTGACACTTGCTGCTTCAACGCCATGCCACTGCTCGTCCTGTTCTTC
TGCTAATAGTATCCATCCTCCGTGTACTTGTTCTTCTGGTGTCGTGCTAAAGTGGTACTGTAGCGTCCATTTGACTAACTTGGGTATTGTTTCGTTCGTG
TTGATTGTCATCATGATGCTATGACAGATGCTCAAGCAGATTCCTTGGATTCTTGTTCGTGGATTCCGTTTCCAGGCACTTGCCACTGCTAGGACTTGAA
ATTTTCCTGCTGCGTAGACTGCTGCTTGTGTGTCTTGTGTTGACATTTCCTCACCTTCAAATATGATCTTGTTTCGTAGTCGCCAAAGCAAAACTGGGGT
CACTGTGGTCCAGATTCTCCATAATGTTGTCATTGCCGTGGTGTGGTGTGGTGTCCATCTAGTGATGCATTTCTGCGCCATCGCTAGAAACTCCATTGTA
AGTGGAGGTGCTGTTCTTGATGCTGCTGCTGGTTCTAGGTCTTGCCGTCTTCGTTCGCTGACTGATTGGCCCATCCATTGGTTGATCCATTTTGCCCATG
CTGATTGCGCTGTTGGGCAGTCCCAGAGTATGTGGTCGATCGTCTCAGTTGTACAGGTGCATTCGTTTTGTGGGCAGCTTTGGTTGTCAGGCCACTTTCT
GTGCCATAGATTTAGTGCTCCGATTGCTGCTCGATATATTGTCCAATTTTGGTAGTCAGTAAACACTCCATGTTGGTCCCATCAATTGTCAGGACTTTGC
GTCAGTGCTGCGTTCCCCCAAATCGATGTTGTTGCTCATTTCGTGATTTGTTTTCGAAAATTTGTTGTAGATCTATATTCTGGGTTTGTCGAAAGTATCT
TGATCGTTGTCGTCGAAGTTGTGCTGTGATGTTCTTGGCCATTGTCGCTGTGTTTGCCGTCCATGGATATAAGGCTGTTTGCGGGTTGGGGGTGAATACT
ATGCCAACAACACGTATCCAAGCTTGTAGTTCTTGGTAGTCCTCGCTGTTCTTGTAATTTGGCGCCGACCATGCAATTCTCCAAGTCCACCCGTCGCTGC
ATAGCTCTAGTCGTAGTACTGGTGAGTGAGTGTTCATCATTGTCGTTGCAATGATGCTGCCCTCACGAGTTGGATCATTGGACCACTTAAGTTGCATCTG
GATCTTGGGGAGAGTTATAGGTGTAGCTGCGTGCTCAGGTTGTTCCCACAAGTTCCATGGTACGCTGTGGAGCACGTTGTTACACCATTGTCTGACTTGT
TCTTCTTGCCGTCCCCTAGCTAGTGATTTCCTTGTGTTCGGTTTGATTTTTGCGCCATGTTCTCCAATTTCAACTAGCGTCGTCATAGCTGTTACCTCGA
TATCAGCGATTCGACATGTTG