Description :
From Genome Similarity Track
Location :
Scaffold_8:128675- 130026
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003843Similar to prr1: Transcription factor prr1 (Schizosaccharomyces pombe)

Sequence
1351 bases(100 bases per row)
CTGTGCTGACTGGGCATACTCGGCAGTCTTGGAATCGGCTGAAGATATGCGTTTGACTGTTTCGGGGCTGCAGGGTTGTGGTGTCCGTCAGACGAATGGC
CAGCATGTGTCCAACCCGCCACTGGTTTTTCAGAAAACAACCGGTGCTGAGTAGGAGGTGTCTCAACGGTTCTCTCTGTCGCCGCCGAGGTCCGAATCGT
TTGGTTGCTTCGCTCCCCTGACCCATTCCATTCTGTAATCAGGGGGTTAGTGGCGTCACGCTCTGCTGTTTTGTTGCGGGGACTAAGTCGCATCCGCTTT
TGTTGTTCCGACTGCTGCTCGAAACCAAAAATGCCAGAACTCTGCTTTCCTCGTTTCCTGCCACCAATTCTGAGCGTCACGCTCATCGGAGCTTGAAAAG
ACGGCAACACAGCGAGACCTGTTGTTGTTTTTGTCGCGAGCCTTGTTGAAAGTTGAGTTGACTGGGTGGTTGATGGCAAAGTCTGGTTGCGAGTAAACCC
TGCGATCAGAGAGCTTGGACTCGACGATGGGATTGTTGATCTGTGCGTTGACCAGCTTTTCTCCATAGTACGTTCACTTCCGTTTCGAGAAAACTCGCCT
GCTGGATGCGCACGACTTGTTGGTGCTGACGGTTGCTCCTTAAGCAAGTGGTTTGGAAATGGATCAATTCTTTGGCGAGGCCTATCAGAAGTCGTGGAAC
TATAGTTGCTTGAGAATTGATCTGTCGAAACCGCACGCGGATATTGAACAGCATGAGTCGTGCGTGTGCGGGAAGTGATGAAGCTATTTTGCGGAGCTGA
TGCCACTTGTAAGGTTTCCAAAGTTTGACCCACTCGCATGTCGCTACTTGAAGGTGGGGGTTGTCTTGAAGCTGACACCTGAAGATCATTGGATTGGTCT
CGCGTAATCGAAGCTTGGGCTTGTGGAGGCTGGTTCCATGCAGTCGTCGAACTTTGCGATCCCTTCTTGGCAGTATGCCTTCTAGCTGAGCACCGGGAGC
TTTGTTCATTCAACTTGCACTCTTGGCACAAGATGAGCTTTACACTGTCGTCGAAAGTGATACGATCTAGTTTATCGAGATGACCTGCTACGAAATCGTC
GTGACGATAGGTTTCAGCACCCTTCTTGCCTTCCTCATCTCTGTGCTGATTTTCACTCACCTCCTTGAACCCATGCGCATGTAGAAAATGCCGAAATGTG
CACAGATTTGGCAGTTGATTCCTCGGCAGAGTGGCTTGTTCAAACTTTTCAGTGTCATGAATGGAAAAGGACGCGCCGCCATTGTTCCAGCTGATGATTG
AAGGATCCTCGTTTGTCAGGATGTTCCACAATACGTGGACAAATCCAGCGC