Description :
From Genome Similarity Track
Location :
Scaffold_8:128670- 129889
Transcript NameFunction/comments
Sapdi_VS20SDRG_03286hypothetical protein

Sequence
1219 bases(100 bases per row)
TACCTTGTAGATCAACGGGGCGGGCAAAACGACCACGATGAAAATGCTCACGGGCGACATTTTACCCACGGGGGGCGCCGCGACGCTCGGCGGCTTTGAC
ATTCTCACGCAGCAGCTCGAGCTCCGGCGGCTAATTGGCTACTGCCCGCAGTTTGATGCACTCATTGAGCTTCTCTCGGTGCGCGAGCATTTGGAGCTCT
TTGCCAAGATCAAGGGCGTGCCATCGGCGGATATTGCAGGCGTTGTCAAGGAGAAGTTGACACAAATGAACCTCCAGAGCTTTGAGCACAAGCTCGCGGG
CACGCTCAGTGGCGGCAACAAGCGCAAGCTGTCGGTGGCGATCGCGATGATCGGGTCACCACCCATCATCTTCCTTGACGAACCGTCGACCGGCATGGAC
CCGGTTTCGCGCCGGTACGTTCCTCTCTCCACCGCGAATGGCATGCGAACATGCGCGTAGGTTCATGTGGGACATCATTGCGGACGTCTCGACCGCCAAC
AAGGAGTCGACGATCGTGCTCACGACGCACTCGATGGAAGAGTGCGAAGCGCTATGCACGCGCGTCGGCATCATGGTCGGCGGCCGTCTCCGCTGCCTCG
GCAGTGTGCAGCACCTCAAATCGCGCTTTGGCGACGGCCTCATGATCGACTCCAAGCTCAACGTGCCGTCGCCAGTCCAGCTCGGCGATTTCTTTGCGCG
CTCGGTCCAGCCCGTGTGCCAGGCGGCAAAGGATCTCGAGACGCATCTGAGCCGGGACCAGGTATACAAGTGCAATAAGATCTGTCATGCTGACATGCGG
CTGCGTAGATCACCAAGCTCTGCGGTGACTTGGGACAATCTGATCGCGCGGGCTGGATCGCAAAGTCGCACTCGACGGGGTATGCGCTGGACGCAGTCCT
CGAGCGCGACAGCAACGTGTCGCTCTCGCTCTTTTGCGCGTGGTGGGTCGGCGAGAACCAGTTTGTGGCCTACGACAGCTTTCTCCGGTCGACGTTTGCG
CGCGTCGAGCTCCTCGAGCGCCAGAACGAGCACTGCCGCTTCAAACTGCACGACAGCGTGGACGCCAAGCTCAAGCTCTCGGACGTCTTTGCGAAAATGG
AGGCGCACAAGGTCGATGTCGCGCTCAAGGAGTACTCGGTGTGCCAGACGTCGCTCGAGCAAATCTTCAATGCGTTTGCGAGCCAGCAGGACGAAGAGAA
GGGCGTCGCACGCGGCATG