Description :
From Genome Similarity Track
Location :
contig_84:128666- 131189
Sequence
2523 bases(100 bases per row)
TGCAGTTAAAAAAGATCCCCAACTTGGCTCCGTCACTGTCGACCAATTCGCTGCTGTCCCCGCGTTATCATGTGCAACCGAAAAGCTGCAAGGCCAGACG
TGTCACGATGGAATTGTGGTAACGCCACTCAAACGCCATCACGGAGCTCCAAAACAAACTCTGTACGTGGCTCTTTCACGAGCGGTGAGCTTGAATGGCC
TCACTCTCACCGAAAAAATCACATGAGAATATCTAGACAGCTTCAAGCCGAATGATGCGACCGTGCTCGAAATACAGCGCCTCATCCAGCTTGTCATTTT
GCCGCCATATGCATCTGCAGCAAACCACAGTGAATTTAGTCAGTGGTAAGGAAAACAACATGCGTAGATGCAACATTAAAAAAAATCCAGTTTTTTGTCT
TCTTTCTTCCTGTTATGGGTGACCATACCATAGCATCATACGTTCCCATCAGCGCTCATTACAGCCGTGGGCAACATGACAGCAAACCGTGACAACATGT
CTCCACGTAGTCCCTGACAGCACACACGCAAGAGGTGAGTATAATCCTAGGTCACCAAGAGGCTAGACTTTGACGTTCTACCTTCCCCGCTGCGACTCCT
TGAGTGAGCGATCTTTTGACTGTGTCTAATCGCTGAAAAAACATACCGTATGCTATTTGGCTGTTCGTAGCTGAAAGACCTCGTGTAGTAAGGTGGCCTT
CTATTTGATGTTTATGTGTTTTTCCCTATAGAAGCCTTATAATATGCAAGACGTGACTTGATGTCTGTCGTCTGTCGAGGAGGGGTTTGTCATTTTTGAT
CTTGAGTCGTGAATCGGCTGAGGTAGGCGTGTAGCAGGTCTTGTGCGACTTGAGAGTTGTGTAGAGTGAAATGTCGTGTCTGTTTGGTATTTGCGAGTAT
GCGTACGGCTTCCAGACTTGCTTTCGCTGGAGTGCTCCATTGGACTGTGAAGAACTGATGGAGTGTCTGATCCAGTACTTGGACTTCATTGCTGTCGTTG
ACTTCGTTGCTTTCGCTTGTTGTTTCCGATACATTGTTGATAGCTTTTTGTGCTGTTTTGTCCACGCTCGCAAGTCGTAGGTATGTCTCTGCTGCTCTGC
CGTGGTGTTCCACTGCTTGTAGTCCATGTGCCAATAAGTGTACTGCATTCGCCTGCCGTGACCCCCTTGTCGAAAAGCTGACACTTGCTGCTTCAACGCC
ATGCCACTGCTCGTCCTGTTCTTCTGCTAATAGTATCCATCCTCCGTGTACTTGTTCTTCTGGTGTCGTGCTAAAGTGGTACTGTAGCGTCCATTTGACT
AACTTGGGTATTGTTTCGTTCGTGTTGATTGTCATCATGATGCTATGACAGATGCTCAAGCAGATTCCTTGGATTCTTGTTCGTGGATTCCGTTTCCAGG
CACTTGCCACTGCTAGGACTTGAAATTTTCCTGCTGCGTAGACTGCTGCTTGTGTGTCTTGTGTTGACATTTCCTCACCTTCAAATATGATCTTGTTTCG
TAGTCGCCAAAGCAAAACTGGGGTCACTGTGGTCCAGATTCTCCATAATGTTGTCATTGCCGTGGTGTGGTGTGGTGTCCATCTAGTGATGCATTTCTGC
GCCATCGCTAGAAACTCCATTGTAAGTGGAGGTGCTGTTCTTGATGCTGCTGCTGGTTCTAGGTCTTGCCGTCTTCGTTCGCTGACTGATTGGCCCATCC
ATTGGTTGATCCATTTTGCCCATGCTGCTTGCGCTGTTGGGCAGTCGCAGAGTATGTGGTCGATCGTCTCAGTTGTACAGGTGCATTCGTTTTGTGGGCA
GCTTTGGTTGTCAGGCCACTTTCTGTGCCATAGATTTAGTGTTCCGATTGCTGCTCGATATATTGTCCAATTTTGGTAGTCAGTAAACACTCCATGTTGG
TCCCATAAATTGTCAGGACTTTGCGTCAGTGCTGCGTTCCCCCAAATCGATGTTGTTGCTCGTTTCGTGATTTGTTTTCGAAAATTTGTTGTAGGTCTAT
ATTCTGGGTTTGTCGAAAGTATCTTGATCGTTGTCGTCGAAGTTGTGCTGTGATGTTCCTGGCCATTGTCGCTGTGTTTGCCGTCCATGGATATAAGGCT
GTTTGCGGGTTGGGGGTGAATACTATGCCAACAACACGTATCCAAGCTTGTAGTTCTTGGTAGTCCTCGCTGTTCTTGTAATTTGGCGCCGACCATGCAA
TTCTCCAAGTCCACCCGTCGCTGCATAGCTCTAGTCGTAGTACTGGTGAGTGAGTGTTCATCATTGTCGTTGCAATGATGCTGCCCTCACGAGTTGGATC
ATTGGACCACTTAAGTTGCATCTGGATCTTGGGGAGAGTTATAGGTGTAGCTGCGTGCTCAGGTTGTTCCCACAAGTTCCATGGTACGCTGTGGAGCACG
TTGTTACACCATTGTCTGACTTGTTCTTCTTGCCGTCCCCTAGCTAGTGATTTCCTTGTGTTCGGTTTGATTTTTGCGCCATGTTCTCCAATTTCAACTA
GCGTCGTCATAGCTGTTACCTCG