Description :
From Genome Similarity Track
Location :
contig_3:1286603- 1289528
Transcript NameFunction/comments
g1041.t1hypothetical protein PHMEG_0006254

Sequence
2925 bases(100 bases per row)
ATGCCCGCCTCCAAAAAGCGCATTCAGAACCGCGGCACACTCAATGTGGGCACGCAGCAGGTGCCGGCGGCGCTACAGGACTGGGTGCACATTTGGCACG
GCGTCAAGGTGAACAACGGGTCACACGACACATCCATCTTCCACGTGGGCTCCCGCGTCGAGGAGATGCCGTTCTGGAAACAATTCATCCGCCTGCCATC
CAACTCGCTCTTCTCCAGGGTCTTCACGAGCGCTAACCCCAGAAAACCGTACAAGGACTTCCTCTACGTGCTGTTGAACATGCGCTGGCCAATGCTGTTC
ACGGTACTGCTGACGATTTTTCTGGTCAACATTTTCTTCTTTGCGGCTGTCACGTGCTTTATCTGTGAAGAACCGACCAACTTCTTTGAGGCGTTTGACT
TGAGCTACCAGACGTTTACGACAATTGGCTTCGGTGTTGTGTACCCCACGCGAACGTGTGGGAACGTGAGCATGTCGGTGGAGTCGTTTGCGTCCATGAT
GATCGTGTCGGCCAGCACGGGTCTTGTGTTTGCCAAGTTTGCCAAGCCACAGGCCAAAGTGGCGTTTAGTAAAGTTTGTGTTGTGCAGCCGTACGGCAAA
AAGTATCTTGCGCTTGTGGTGCGGGTTGCAAATGCCACGCAGTCACGTGATGTGACGCACGACGTCATCATGGAGGCTGTATTCAAGGTGAATTTGCTGC
GTGTTGAGCACAAGACTAAGCACATTCGAGCTCACGATGACGAAGTCTCGGAGAAGCGAAGGCTTTCTCGTGCAGCTAATTACGTGATAAACGAAGCTGA
AGATGCAGTGGATAACCCCGCTTGCTCGCCTACAAAAGTGCTTACATCGTACAACCTCAAGCTACTGCAGAACAATTTCATCACCTTCCGTATGGGCGTA
GCCGTCGTGCACGTGATTGACGAAAACAGCCCGTTGTATGGAATGTCAAAGAACGACATTGCTCAGTCGGATATGCTCGTAGAGGTTGCTATGTCAGGTG
TCGATTCCACGCTGCAAGACACAGTGTCCGAGCGATACATCTATACGGCAGTAAATTTGATGTGGGGGTATCGTTTTGCTGAATTGCTGGAGTTCAACGA
GCGGAATGCAGAGGTCATTATGAACTTCGCAAAACTCAGCACGGTGGAATCCGCTCCAATCGACGATGCCCGCTATCTCAAGCCAGTTGTCTCGAGTGGA
AAACCTCGTGGGAGTAATGAGAGTGCAAATAGCGGGCACTCGCACAATGTAGCTGACCGCCGTTCGCATCATAAGTCAAGGGTGTCTAGCCACCAGGAAG
AAAACCACCCGTATCATGACGAGGCAATTCATGAAGTTCCGGCAGAGTATTCGGAGCCTTTCATGGTAAGCTCAAGATCAGGATCTTGGGACGCCCAGTC
ATCAACAGACCACGCGATGCCCGCACAACCACACCTCCAGTACAGTTCCCGAAGAAAAATGGACCAAAAAGTTTGCAATGGGTCTAGAGCCTCTGTTCGA
ACCATTGCTGCAGCAACCGTTTGGAACACAGCGGATACCAAAAGCCCCTTCCGCTGAAGCTCGAGCCGCTCAAAGGGGAGGACTGCGTGTCTTGAGGGCA
AACGAGCAGGTAGGCCTGGAGGATGGTCGGGGCGGACAGGCTTTGACTGCAAATGAAGACATTAATGCTCGAGGCCGCGATAGTAGCGGGGTGGGCGTAG
CAGCGGTGGTGGTCGGGGCTCATTCGAAGGACCGAACCATGTTCGAGCGAAGGACCTGCTTCAAAGAGAAATGGCAGGGTCAGCTTTGATCGAGGACGAC
ACGAGTACAATTTCTCAGGAGGAAGGGCACAAGGATGATAGTGACGATGCTGACAACGTCGACACTGATGCCAGTGACGGAGAAGACTGTGTGGAGGACG
ACTATGACCAAGATGACTATGACCAAGATGATACTCCTCGGCAACGGTTGCGGGTTCAAACGACTATGTCTGCAGTGTCGATTGAGGTTGAGGACACGCC
TCGCTTCTTGCGCATTCTTCCTGTCCACATCCCGAAGTCTTTCAGTTTCATGCGGTTCTACCAGAGTGCTCTCCATGTGGGCTGGCCAAAAATCATTGTT
GTGTTCGTACTATCGTTTCTAGTACTGAACTTCGGCTTTGGTCTGCTGTACTGGTTTGACGTGAGCCACATCTCAGCGTACACCGATGTGGTAGTCTCCG
ACTACGAGTTGGCCTTCTACATGAGTGTTCATACGCTTGCTACGATCGGTTACGGCTCGATGGCCCCGATGCCTGATGCCGTTTACATGAATGTAATCGT
GTTCATTGAGTCGATGGTGGGTATTATCGCCGTGACAATCATCACAGGCATCGCCTGGTCCAAGTTTGCGCGACCCCGAGCACATATCCACTTTTCGTCC
AAGATGACCATCTCGACCATCTATGGTCACCGTTGCCTCGTTTTCAGAGCTGCTAATACAAGGCACTCCGGCGAGGTGCACGAGAACTTTTTCCGCATCG
GCGTGATCCTCACAAACCGACGCACAGGGCTGCGCCAGATGTACGACGTGCCCCTGGTTACTGCTGAGTGGCCGTCTATCAAGCTGCCAGCGACACTTAT
CCACGTCATCAACGAAAACTCGCCGTTCTACAAGTTTCACTCGATGGAGGACTTATCGCAGTCGCGCGTCGCAGTCATCGCTTTGCTCACAGGCCTCGAT
ACGACTTTCTCGGAGAATGTGTACGCGCGCAAGATGTACTTCTGGGACGATTTTGCGTACGACATGCGCTTTGCTGACTTCGCCGTTATTGAGCGTGACC
GCGTGATCGTGGACTACGACCGCTTTGATCGACTCCTTCCAGAAGACCGAGAAGAGCAAGTTATGACCACTCCTGTGCTCTCTGTGAGGTTTTCTATCGC
TGACTCAGTTTAATGTAGATGGTAT