Description :
From Genome Similarity Track
Location :
Scaffold_98:12866- 15168
Transcript NameFunction/comments
Physo_141397predicted protein
Physo_141398hypothetical protein

Sequence
2302 bases(100 bases per row)
CAACGGCGCAATGAACACCCTTTCCTTCCCTTAAATCCAGCATCCTGTCTCGCTAACATGCTCTCGAAGCCTACAGGTTGCGCGTGCGCGCCAGGGTGCT
GAGTTCCACGAGCGAGTGGCCCGTTCGGAGAGCCATCTCCTCAGCCGTCTCGTGCTTGGACAGGGCGTCGAACGTGGCCTTGACGACGGTGAAGGGGTTG
CGCTGGCCGTGGGTCTTGGACACGACGTCCGTGATGCCGAAGCAGTCCAGCACACAAGCCACCGTATCGCTGACCGTGAGTCCCTTGTCCTTGGGCGCCG
GGCGCAGGAACAGCGTCGAGCTGTTCCACTTGCCGCGCACTTCGTGGTACAGCGTGCGGTCGTCGAAGCGGTCGACGTACGTGAAGCGCTTCATGGCGAG
CTTGGTGCCGCGCTGGATGGCAATGGGCGGCGACGAGCCCTTGCCCACGGCATATCCGGCGACGCCGCGCATGTTGCCGACCACCACGAGCGCGCGGAAG
TTGACGATCCGCTCCTGCGTCGTCACCTTCTGCACCTGGTCCACGTGCACGATCTGGCGCAGCAGGCCCATGCGGCCGAGGTTGAGCTCGCCCTCCTCGT
CCTCGTCGGCGAACTCCATCTCGTCGCCCTCCTTGTTCATGGCGCGCATGTCGCGCAGGATGCCGGCGTCGGGGTTCAGGTACTGGCCGGGCTGGTCCGG
GTCCGCGAGCGTGAGCCCGTCCTTCTTGAACTCGTCCAAGAGGCGGCGGCGCACCTTGCCACGGTTCTCGGGCGCCACGGCCATGAAGCGGCTCTTCTTG
GCGGCCTCGGGCATGATCTGGCGGCGCGGCAGCGAGTCCTTGCGGTCCTTGTCGATGATCTTGTCGGCGCCCTCGTCGAAGTCGTCGTCCGAGAGGCGCC
AGTCGTCCTCGGACGAGAAGCAGGCCACCTGCAGCTTGGCGGCGGTCTGGCGGCCCTGCTGGCGCGCCACGGAGGCCGCGCCCGAGCGGACGGCGAAGCG
CTGCAGCATCCTAAACACCTAGATGAAGCTGCGCACGGCAAGGAGGGTTAGTCGCGTCAACAGGAGCGACGCCGACAGGCGCATCCATGAGCCTTACCGG
GAGAAACCCCAACGAATGAGTGGCCGAACCTGCGGCTCCCCTGAGGCCAACGAGTTTGACGGGATTTGCAAGTGGCAGCATCATAACGACACACCAAGAG
GTGTGGCACCATCATATCGATACACCAGGAGGCGTGGCGCGATCATATCGATACATCCAAAAGACTGCGCCATGCGTCTGTCCGCACTGGGCGGTTGATC
GATCATGGCGACCCCAGGCGACGCCGAGAGCGCGGCGTCCTCGGCGAGATGCGCGCGGGCCGACTGCATGTCGATGCGCGAGGAGCTGGTGCTGCTGCGC
GGCGACCTGCTGGAGCTGGAGGGCGAGAACGAGCAGCTGGCGGCGCTGCAGGCGGACGCGAGTGCGCGCGAGCTGCAGACGCAGAAGGCAGCGCTGCAGA
AGGACGAGGAGATCGTCCGCCTGAACGAGACGGTGGCGGGGCTCACGGCGCAGCTGCAGGAGGCGCTGGACAAACTGCAGAGCGACGGCATCGAGCAGAG
CGCTAAAACGTCGCCGGAGAAGCCTAATTCCAGGCCTGTAGAGCAGGAATTTGAGGCGCTAAAGACGCAAAATGAAGCTCTGGAGGCTAAACTCAAGGAG
CTACAGGCGCAGCTCGAAAGAGAGGCCACTGCCGGCTTGAAGGCGCAGCGACAAGTAGTGCAGGTGGCGGAGGAGAGCAAGGACAAGCGCAGCGAGCTGT
ACACGGCGCTGAAGGAGAACGAGGAGCTCCGAGATGAAGCACAGGAGATGCAAGAGGCAGTGAAGAAGATGACGGAGCAGGCCAAGGAGTACCAGGCGTC
CATGCAGACGATGCAGGATCAGCTGGACGCGTACCGAGACGCGGTGGACGAGCAGACTCTGGAGATCACGCAGCTGCACGCCAAGGTGGAGCAGCTGGAG
CAGGAGAAGGTGAGTGTGGAGGCCAAGTTGATCGAGATGGACGAGCGGGAGAGCGACGTGGACGCGCTGATGAACGATGCCAAAGCCAAGTTTGAGATGG
AGAAGGCCGTGCTGCTTGCTGAGCTGGATGAGATGCGGCGCAAGTTGAAGCAGCAGCAAATGCTGCATGAACAACAGCAACAGCAAGTCCAGGACAGTAA
GAAGGCGCTGCAAGAGGAAGAAGAGGAAGATACAGTTCGTGGTGGTGCTAGTGCGCCCATGGAAGATCTGGAGAAGCAGCTTGAAATGCTGCAAGAATTG
CG