Description :
From Genome Similarity Track
Location :
contig_43:128639- 129793
Transcript NameFunction/comments
g7473.t1AAY43365.1 aspartic protease [Phytophthora infestans

Sequence
1154 bases(100 bases per row)
TTAAGCAGCGAGCGCAAAGCCGATGCGCGGCTTGCGGGTGTCTGTGCCCCAGTCAAACACCGTGTAGTGTTTGCGCATGAACACGTCGCCCAGGATCCAC
AGCGGGCCAGCGGGAGCTGGGATGTCAATGCCCATGAAGGCGAACAGACACAACGGCCCGCTCTTCAACGTGTACTCGTCCTTGGTCAACGTGTACGTCT
TGCCATTGAGCACGAAGGAAATATCGGGCGCCGCGGCCGTGCAGCTGATCAGATACTCGCCCATAATGAACTTGTACGCTCCCACCAGCTTCGCGAGCTT
GGCCACCTGGTCCTTGGGTCCTGCAATGAGGGACGTACCCGAGTCCACAATGGCCTTGTGCACGTCTGTGAGTTTTTCTCCTTTCGTCTCCACAGCGTCC
AGTGCCACCGACCAGTAGGTGGCACTCGTCACGTCCACATACTCCAGCTCGCCCTTATAATGAGCTTTATCCACCCCTCCGAACGTGAGCTCGCCGTCCT
TCTGGTCTCCCAGATAAAAGGCAAACACAGGATCATCCAGTAATCCTTGCTGGATCATCCGGTGGGAGGGCGTCTTGAGGTGGTCCACACTAATCGTGTC
AAATGCCAGCCCGAACAGGCCGTCGAATTTGCCCAAATAGTAGGCAGGGCCCAGGCCTTTGGTCACGTTCACCTCGGCGAAGAACTGGTCGGCCACTGTC
AAGCCGCCCAGCTGCAGCTCGTCCTGGGACAGGAAACCCGACACGGGCCCGCTGCCGTACTGGATTTTGAACTCGGTACCGTTGGCCTTGTACGTATGCG
ACGCGTCGTGGTCGTACACTTTGTGCGCGCCGAACTTCTTGTTGGGCACCCAGAGGTTGCTCGAGCCCGTGTCGAAAATGACCGAGAAGGGTTGGGGCGG
CGACCCGATCGAGATGGCGCCGTAGTATTGCGCGTTCTGGAAGTCGCGGATGACGACGTTCGCCGAATCTTCGACATTTTCGACGTCGGGGTTGAAGGTG
TCGGAATTGGGCTCTTGGGGGCTCCAGACGGCGGGGCGCTGCAGCGCGTGCACGTCGCGTAGCAGCGAGGACACAAACTCGTCGTCGCTGCGCTTGATCA
TGGGCACGCGCAGGACGGCGGCGTCCGAGGCGAGGAGCAGTGCCGAGACGAGCA