Description :
From Genome Similarity Track
Location :
Scaffold_39:128604- 130856
Transcript NameFunction/comments
Physo_135552predicted protein

Sequence
2252 bases(100 bases per row)
AGTTACTTGATGCGGGATACAAACTTGTATTGGCTGAGCTGTTGAAGTGAGCCCTTCTGCACCATAGCTCGGATCGCGCGTTGGATAGCGTTGGGGTTGT
AGCCCTGGGCCTCGAGTCGACTGTACAGCGCACTGGTCTCCACGCGCGTGCCAATACGCAGAGTGCGGTTGATACTCTGCTCCACCTCCTGTGCCTTCTC
GTGGAACCCGCCGAATAGTCCTTGGGTGCCGCCGTCCTTGGCGGCGTTCATCGTACTCACACTGAACAACCGGATCGCCTCCTGCACGTGCTCGCGCGTG
GCCTCATTGAGTAGACGCATCTTCGCGAGAGACTCCGAGATACGCACAAGGGCTTCGAGCTGACGCACTGTAACCGGAATCGTGGTTTCGCCTCCTTGGG
TACGACGCACATCGTCACGTACGCCAACGTAGAAGTCCTGCAGCGCCTGTGCTGCTCCAACCGACAACCGTGGTGCACAGCGCGTGCGGCAGTACGAGAC
GAACTTTTTCAGCAGCCACGGCTCGAACTCTCCACCACTGGACGCACTTTCACTGGCCGAGGGCTTTCCCGCCGCCGACGCGAGCGCGTTGGTGTGCATC
CGCACGACGTGAGCTGCCATCTTCCTGTCTCGCGCGTCGTCCTGGATATCGCGCACGATGAAAATCATATCGAAACGACTCAGAATCGTGCTCATGAGGT
CGATATTCTCCGAGGCAGAGCGCATATCATCGTAGCGACCGAACACAGGGTTAGCAGCCGCCAGTACGCTTGCACGCGAGTTCAGAATGGTAGTGATACC
AGCCTTCGCGATAGAAATCGTCTGCTGCTCCATGGCTTCGTGGATAGCCACACGATCGGACTCGCGCATCTTGTCGAACTCATCGATGCACACCACGCCA
CCATCAGCCAGCACCATAGCACCTCCTTCCAGATAGAACTCGCCCTTGGAGTCACGGATCACCGACGCCGTCAGACCTGCAGCACTACTGCCTTTACCCG
ACGTGTAGACACCCACGGGGGCAATCTTCTCCGTAAACTTCAAGAACTGCGACTTGGCCGTACTGGGGTCTCCCAGCAGCAGCACGTTAATGTCACCACG
CAAGATCATGCCATCGGGTAGCCTCTTCCTCGATCCTCCGGCCAGTAAGCAGGCAATAGCCTTCTTGATGTTCACAGTGTAGTCACCGTAGATCGACGGC
GCAATGCTCGTCGCGAGCTTCTCGTACAGCTCCGGGTGTCTCGCCATCTCGTGGAACTTCTCCTCCTCCGCCGGGGAGAAGGTCGCCTTGGCTCGTCCCG
CTCCTTCTTCATCAATCTCAATGCCCACCACGCGCAGATACAGCGTGCGGATGGCCACAGCGCCGACGCTCTTGCCTCCAGCATTGACCACGGACGTGAT
CCCCACCACAGACACGCGTGTGCCCGGCGACGCTCGGTCCACCAAGTGGCGGTCGGCGATCAGCGCCAAGTTGCGCGGCATTTCACCCGTGGGGACCACC
TCGGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCCACGTACTCGCCCTTGTCGGGCAGCACCATGTACGAGTCCTTGGGACAGAGGTCTCCGGCCGCCA
CGCTGGCGTCCTCCTCGCGGTTGCGGTCGCACACGCGCGGGATGCTGACGCCGCCCATGCCCGACACGGCCACGCGCTTGGTGTGGCCGCAGTTGCGGCA
CCGCAGCGTGGCCGACACGCACTTGGTGCGCACGCGCGTGGCGCTGATGACGATGCCCGGCACCTTGACGAGGCGGTTGATCTCCTGTGCGTGCACGTGG
CGGAGCGGCACGGCCGCCTGGTCGCTGGTCAGGATGGCCTGGATGTCCGGCAGGTTGCTGGTGGCCGCGCGCGCGCTGTCGGCCGCGAGCGCGTCGGCGC
CAACGCCGCCGGCCTCGGCGCTCTGGCTGGCCACCAGCAGCTGCGCCAGCATCTCCTTGGCCGCGCTCTCCAGCAGCGGGAGCTGCTCCTTGGGGTTCTT
GAGCAGCAGGTCCTGCAGCTCCTGGTCGAAGGCCGCCACGTGCGAGAGGTTCACCGTCACGAACCAGTGGTTGCGCCGCGCGTTGGCCAGGAGCTGCTCG
CGGTAGAAGAAGAGCGGGCCCACGCGGAAGCCGCGCAGGAAGGCCAGCAGACGCCGCTGCAGCGCCGCGGGGCTCGCGCTCTGGCGCGCGTCCGACGCCT
GCGCGCTCTCCATGCCCACGGCCGACACGCGACCCGCATCCCAGTCCATTGT