Description :
From Genome Similarity Track
Location :
Scaffold_663:12858- 14546
Transcript NameFunction/comments
Phymu_g11431hypothetical protein PHYSODRAFT_354994
Phymu_g11432ubiquitin carboxyl-terminal hydrolase, putative

Sequence
1688 bases(100 bases per row)
CTTTTGCCACAAAAGCGAATAAGAAGTCATCGAGCAGCTATGCAGATCCAGATCAAGGTGCGTGCCAAGCCCCGAACAGTCTGAGAGCGATACACTAAGC
GTTAGGTTGCTGCAGACACTCACGGGCCGGAAGCAGACCTTCAACTTCGAGCCAGACAACACGGTACGGAGTGTGAGATCCTAAAGTTGCTGGAACGGGT
TGATATTGATGCTCTTGTTCGTCTTTGGGAGCAGATTCTGCACGTGAAGCaagcgctgcaggagaaggaaggCATCCAAGTGGACCAAATTCGCCTCATC
TACAGTGGCAAGCAGCTGTGCGTTCTCTTGGGCTCTGCTAAGTATGATTTCCAAGAAGTCTGTGCTGACATGCTTTCtctgtgtgctgctgcagagcgGA
CgacaagacgctgcaggactATAATGTTGCCGCAGGGGGAACTATTCATAtggttctgcagctgcgtgGAGGGTGCTAGTGCGATGGCGTCCCGACGGGG
TTTTGAACGAGGCTGCCGTTTCCAGAAGACCGAGATAGTTAGAGTAacacgtcgacgccttctACACGCCTCCAACACTATAAGCAGCCCCACAAGCTGC
TAAACGCGCCAAACTCCCACGCACATGGATCGATTGATTGTTTCTTATCGTCACTTTTGCTGTTCTttcagaaaaaaaaaactcttTCTACTGCGCGTTC
GTGGGCTTCGCTGCGTTTGCGGCAGCGCGctcgtcgagctgctgcttgatcaaCGGCTCCAGCTGTTTCTTCTCAGCGAGCGTCTTCAAAAGCTGGATGA
TGAAGGGAATGTAGTTGTGCTTACGGCGTTTGTTCTCCAGCGCCCAGTTCTCACGCTTCTGCTGTTCAGCAGCCAGGTCAGCTTGGATTTGGGCTGCTTC
GCTTTCACTCCCACCCGCTTCAATGAccgcttgaagctgctcttcgtaCGTCTGTATCCGGTTCTTCACCAGTGCCAGCAGATTGAAGCGGATCTCCGTA
GCCGAGTACTTCTCGATCCTTTTCTGAATAACAGGACAGGCCACCTGCAGCCAAGAGTCTCGGTTCTCCGGCTCTGAGACCTCACCCAGGCAGATAGGAC
CTTCCCTCAGTCCATCAAGTTCGTAGACTTTGCCGTTCACAGGAACGTAAGCCACAAAGTGATAaacgtcgtcatcttcagtAGCCTTTCTCTCCTCCAC
GACAAACGGTTCAGCCCGAGCGAAGGAATTATGAGCAAGACGGATCTTGTCACTGTTAGAAATTGCCAGTCCCTTGAGATCCGACGGAAAGTCGCTTGTG
AAGGCCCTGAACTCAGTTAAAGTCTCTCCCAGCTCAATATCCTGACTATTCAGCAGAATCGACAGGATGGCCTGCGTGGCGCAGGCGTTGCTGATCACTT
GCTTGGCGAAGAAAAGACCATCCTCTTCGCTGGCAAAGACTGGGGGGTCCGCGACTTCGTTCTGGTTGCTTTCATACTTAAACAGGAACACCAGGCCGTA
GACAGGAGACAACTCGGCGAACTGatgctcgtccagcgtgtagagctcctccacttggACGCCATTGACACCGATGTCCTCAATGAGAGCGGTGAATACG
CCTGTGGCGGGTTAGAAGCGTCAGATAGAGAGGTAATCCAGGGCGGAGAGGACGTACCGGGATCGGACTCGATGGTGCACCAGGACAT