Description :
From Genome Similarity Track
Location :
Scaffold_528:12857- 16836
Transcript NameFunction/comments
g14232.t1POM60411.1 LOW QUALITY PROTEIN: Pol protein [Phytophthora palmivora var. palmivora

Sequence
3979 bases(100 bases per row)
CGTAAGCTCTCTTCCATTGTCGCGCTGCAAGCTAGCTTCAAGAAGGACGACGTCCTGTTAGAGCGTTGGCTCCGGTTCTCGTTCGCGAAGTTAAAGGCGA
AACGCCAACTTCCTTCGGGCCTCCAGCCCCGCCCTGCGCGGGCTCCTCAACATGATCCTCCGAGCTCTGCAGACCTTCCACAAGGTGTATCGTCGGCTGC
AGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCTCGCTCCCCGACCTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCC
CAGGGCGCCGTTGATCGTTTCGATCAAAAGCGTCCACGACGTCAGGGCAGTCTTGCCGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGAGGTA
CCCTCGCCACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCACAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAAC
GCCGGTGGCGGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCTTGAGGACGCTTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGT
GAGACTCTCCATCAGGCCGAGAACGCCTATGATCGCTCATGGCATGAGATTGATCAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGG
CGAACCGGGTCTCCGACCTTGAGCGAGGTCTGGCGAGGCTGGAGGGTCAAGTCGACCTTCTGCTGCGACTTCAGCAGGGTTCTGTGGCTGTGCCACCTGT
GCACGTCCCGGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGGTCCCGGTACGGCTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCG
GAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCACGACTTTGAAAGGTCCGATGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGCATG
TGTAGGTAGGTTTTTTGCGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTTCAATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCT
TGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACGCGTTGACAGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAG
CAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGGTAGCGTCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGT
AAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGTGGAAGCATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGG
ACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATGATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGG
ACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCGGGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGT
ACCTTTACCATCAATGGTGTCCGGCACCGCCGCTAGATGAGCCATCTTGCTCAAACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTC
GGAAGGCCGAACACAAAGTCCATACTCATGGACTCCCAACACCCAGAGGGTACAGGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCC
GCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTGGGCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACC
AAGGTGGCCACTAAGCGCAGTATCGTGTGCCTCATAGAGGATACGATATTTCAGATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCG
GTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTCGCGCGTAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCC
CAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCGCGGATCAAGTCCGTCACGGACGACGTCACAGTCGTGGCATGAGATAACTC
ATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCTTGTACTTCACCTCGAACTTGTACTCCGCAAAGAAGGAGAGCCAGCGG
GCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGGTGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGA
ATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCA
TTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGATGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACGCC
AGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGCTCGGTGTCCCAGGCCCACTCCGCATCCTTCTTAAGGAGATTGGACA
ATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGAGGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCA
GTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTG
GATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTGTCCACATCTGATTTCCCGTGCTCGGCACGAC
TGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGAAGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTCGACAG
CCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCA
TCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAGAACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCAT
TGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCC
CGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGG
TCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTACGGATCTG
AAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGTCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATC
TTCAGGTCGTATAAAAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGCCTCGCCGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCG
GCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATTAACGAGTGTATATAGCTGTTCGCTATCCACCACCCCCGACACTTGCT
GTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTCTCCTCGCGGAGACCATACGCCTCGG