Description :
From Genome Similarity Track
Location :
contig_16:128564- 129909
Transcript NameFunction/comments
g3570.t1pol protein

Sequence
1345 bases(100 bases per row)
GCGTCGACAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAGCCAGCGGGCCATCCTCTGAGACAAATGCG
GAGAGTTGGTGGCCATCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATAGGAGCT
CCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGTCTGGACTGGAACGAGATGACTCGCTCGTGCCCGTCCGCGTCGTGTTGCAGCAGCGC
GCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGATG
CTGTTGAATGCATCCTGGTGACGGCTCTCCCAGCGCCAGTCGCCATCCTTCTTAAGGAGATCCGACAGGGGTCGTGCCAGCCCGGCATACCCCGCACTAT
ACTTGTGCAAGTAGTTGGCGAGGCCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTGGGCCAGGCCGCAATAGCCTTGACCTTCTCAGGGTCGGC
TGGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCATG
ACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGTACGTCTGCG
TGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGAGCATTTGATAGACCCTGTGGCATCACTAGCCACTCCCAGAGCAT
GCCGCTCCGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAG
CCCGCCATGTTGTTCAACAACACATCCTTGCGGGAGATGGGTGTCTGGGCGGGAACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACT
TCCCGTTCGGCTTGCGAACGCAGATGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAAT
GACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCCTAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGA
GTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCA