Description :
From Genome Similarity Track
Location :
Scaffold_456:12856- 14662
Transcript NameFunction/comments
Phyag_g5861myosin-like protein

Sequence
1806 bases(100 bases per row)
GTTGGGCTTCAGACAGCGCACGTAGTGGCAGTCAGTGACATTGATCGTTTCCAGCAAAGTCTTCAGCTGATTCCGGAACTGGAGACCCAGGCTCACTCGC
GTAGCAATGCTTGAAGCTCTGcccttcgtcttcctcgaagGCGTTTTCTTCTCAGGTGAAACCTGCAGAAGTCCACGCACAAATGGCTTCGATGATCGCT
TGATGATTGCAGTGATTTCCGGGTACAAAAtgtccttgttcttctcaCAGAACCCAAACGTGTCGTACgaaacagcaccagcatAATGATGCACGACAAA
CAGGTGGTTGGCCATCTCTGTCTTACTCGCACTGAAGTGCGGGTTCAGCTCGTGCTGACGGTACAGCTTTCGCGCAAAGTTCTGGTCGTTTCCCTGAGGA
ACAATGCATTCTTCGTCAAGCGCTGGAAGGATGCCGTACGGTTTACCCTGAATCAGGTCAATGCACGGGCCGTTGTCCGGGAAGTTGATAAAGCTCCACT
GAATTTCTTCCTTCTCGTacgtctcctgctccatACGCAAGACAGTGAGGTTgaagtgttgctgcaacgtctCGTTTGCGTAGTTGATGCAAAGCTGTTC
GAACGAGTTGTGCTCCAGGTCCTCGAAACCAAAGATATCCAACAGGCCGATGAATGGGACATCACGGTCCTCGTACTCCACAATTTCGTTGATTCGGCTC
ACGAGCCAGTCGAACAGCTTTCCGTACAGGAATCGAGCAAGAGCGTCACGCGCGTTCTCAGCGGCATCCGGCAGCAAGCCGATGGAGTAGTGCTCGTCCT
TGGTCTGAATATTGCGGTTACAAATAGCCTGCTCCAGACCCTCTTTGTCCACCTCAAGATAGTcgagcaccaccttcatcGAATCTTCGCAAATGTTGGA
GATTTCAGATCCTTCTGTACCCGAAGCGTGGTGCGTCTCATCAAATTCCAGATTTCCgatgtgcagcagcgccgagatCGTAACGAAAATGCTCTCCATG
TCGTCCTCATCGAAACCCATCGTCTGCATGGCATTCTTGAGGACACCGAACTGCTCCGCGTCGTTGACACCATCCTTACGCTTTACACATGTGCTCTGAT
TCAGGTAGTGGAACTTAGTCGGCGCCTTAAGActccagcgcttcttctcctcggcaGTAGCGCCAGCAATGATCTCGTAGAAAATGTGGTAATTGCGCTC
GGATTCGGCCTGGTACGCCAGtctcaccttctccagcaaatACGTCTGGATGGAGGCGCCAATCAGACTTCCCTGGGCCGAGAACTCCATCTTGATGAAC
TTTCCGAATCGACTACTGTTGTCGTTACGGATCGTACGCGCGTTACCGAAAGATTCGAGGATCGGGTTGGACGATAAAACCTGCTTCATGACGTTGCTGT
CTGCGTCGGCATTCTTGTGCTGCGAGATGGTAGCCAAGTAGTTCATGACGAACTTGGTGGTTTCGGTCTTTCCGGCGCCACTTTCACCACTCACAAGGAT
CGACTGGTTAGCGGCGCCGCCGTTTGAACTGTGTCCGATGGGGTTCATGAGCGAGCGGTAGGCCTTGTCGGCAATGCTGAAGACGTGCGGCGGCATGTCA
GGCACTTCATGTCCGAGGGCGCGCTTGTCTCCATTGCGGATGTACTTGCGCGTGATCTTGTCCGTGTAGATGCCGAGGTTCTGGAAGGGGTTGATAGCCA
GCAAGATCTCGCCCGTTAGCGTGTAGATCTCGTTAATCTTGAAGCGCTCATTGAGCGTGTGGCAGATGCCTGGCTCGTGAAGGTGCGGCAGCTGGATCAG
GTCTTC