Description :
From Genome Similarity Track
Location :
Scaffold_347:128552- 130459
Transcript NameFunction/comments
Aphin_H310_11659cobalamin biosynthesis protein CobW
Aphin_H310_11660protein kinase, putative

Sequence
1907 bases(100 bases per row)
TGCATAAGGGTTGAGAATTCCTTGTAGTCGATTTTGCCGTCGCCGTTTTCGTCGATCGACTGAATCAAGTCGTGGAGTTCCGCGGGCGAGATCGGAGTCT
TGTCCAACACGTTCATCACGTACGCGAGTTCGTCCGCGGAGATAAATCCATCGTGGTTTACATCAAATATCTGTCCACAACCAACGTCAGCCACCCGTTC
TCCACAGCAACACCCTCAGCCACACGTTCGCTTGCAGTCACACGTGCTGTTGACGCTGTTAAATGGTTCAGCATTTAAGTACCTCGAACGCCGCGTGCAG
ATCGGCGTCGTTCCACTGCTCAACTTGGATCAAACTGGAATTGACCAGGGTCGTAAACTCTGTCAGAGAAATCCCTCCATCACCGTCCACGTCGGCAGCT
TTCATGATGTCGTCTATCTCAGCCCTACGAGGAGCGTTCGTTCGATTCGTCAGCATAAAGCACCGAGGCACATTACACGGACTCCTCGAATGCACGCAGC
CAGCGCATTTCAATTCACACATAAATGCAAGGCTTCGTACGGGGTGTATTGCTGCCCCAACGCTCTCAACACGTTCGCGAGCTCGTGCTTGGATATTGCG
CCGCTCTGGTCTTCGTCAAACAACGCGAAAACTTCCTTGTATACGTCTTGGTTGAGTGTCTCGAGGTCCGTTGTGTGAGGCGCGACCACGTGCTTGCCAG
ACGGTGATTTGTGCAGTTTTTGGGACAGCAAGACCGTCACAATGTTGGCCCGCAGTTGCTGCAGACGACGGTACGCTTGCAGCCGCCCGGACAGACCATC
GCGGTACCGACGACTCAACCGCCGCCGAAAGCGAGGGTTCATCCACGGGTGCGAGAGCGCGTCCGCAGCCGTAAATCGCTTCTCCGGATCCACCGTCAGC
AAATGCGACAGCAGGTCTTTCGCCTCATCGCTCAGGCTATTATACCACGAGTTGGACACTACATGCAGCGTTTCCTGTGCAATTGAGGTCGACGAACTGA
ACGTTCGTACTGTCATATGCCCCACGCACCGCCAGGCTAATGATTTGGGCGTCGGAAAAATTGCCTTTCGGGTCGAACGGGTGGATACCAGTGAGGGTAA
TGTACAGCTTCGTCGATGACGGTCAGCGTGGTAAGCACAGGGAGGAGAAGAATATAATCGCACCAGCACCCCAAACGCCCACATGTCGACGGCGCAGTCT
TGTGGCGCCCGCTTGATAATTTCCGGGGCCCAATACACACTGCAACAACGCCATGCACTGTTAGCAGCTCTCGTTGGTTGCTTCGTACATGGTGCCCCCG
GCAGGCGACTCTGTCAACTTCGATCCAGCGGGAAGGCGCAAACTTTGGCCAAAATCCTACTCCGCGATCAGAGACTTGGGAAAAGAAAACTTCACATTTA
CGCACTGCGATCTTGATATCTGCGTCTGGCGAGACTTCGGTCAAGAGAAGGTTCTCAGGTTTGAGGTCACGGTGGCTGAAAGGAGGACGTTGAGATGGGT
CGTCGGAATCTGCGAATTATGTACCATACACCACGTTGATGCAGATGCTGGAGGGCGAGGCAGACTTCGCGAAGCATGCGGCTTGCGTCGGCTTCGGTGA
TAGAGCCCTTGATGCAGTTGAGCGAAGGTGGCATCGAACTATGTGATACATGGTGTACCTGGCTCACGATGTAGTCGAAGAGTTCGCCACCACGGACGAG
ATCCATGATCATGATAATATCTGTGGGTTCGTAAACAACGTCTCGCAGGGACACGATGTTGGCATGTGTACCGATCCACCTCAACATGTCGATCTAGGTC
GATGGGTCCACTGTGTCATTTCGTATGAAAATGTTCATCTCCCTACCTCAGCTTCAATCTCTGCTGTCGACGCAGTCTTCATGTCGAAAAACTTTGCTGC
GACTTCC