Description :
From Genome Similarity Track
Location :
Scaffold_15:128522- 130913
Sequence
2391 bases(100 bases per row)
TGACGGAATTCAGAGATGTGTTCCCAGAAACAGTGCCGTGCGAGCTACCCAAGGATAAGGGTACTCGTCACGAGATAGACTTGAAACCAGAGTCAAAGTA
CTGTGTCATGAAGCAATGACCACTGCCTCGTGAACAAGTACTAGCGATTGACAAATTCTTTGCCGATCGCTTGGCAGAGGGCCATGTGAGGGAATCTACT
TCCCCATATAGCTCTCCGACCTTCTGTGTCCAAAAGGCCACAGGAGGATGGCGGATATTTCACGCATTCAACAAGTTAAATGCTGCCACCGTACCGGCTC
AAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGGCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATCCTTAT
GCTTGAAAGGGAAATCCCTTACACAGCAGTGAGCACCCCAAGCGGAATTCTTTGGGAGTGGCTAGTAATGCCACAGGGATTAAGTAATGCCCCTGCTACG
TTCAACAGATGTGTTACGAATCTGTTGAGATCTGTGCGAGAATTCGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGA
CGGATTTGATAGTCCATCGACTCCACGTACGGAAAGTTCTTACACTGATGCGTGAGCATAAGTTGTATGCCAACCTCAAGAAGTGTATATTTGCTGCAAG
AGAAATACCACTTCTTCGATGCATCGTAGGTAAGCACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATA
AAAGGACTTCGAAAGTTCCTTGGACTAGCGGCGTATTTGCACAAATACTCGCACAATTACGACGAGATGACTGTTCATCTCTCTTTATTGAAAAAGAACG
AGAAGTGGTCATGGAGTGCTGATTGCCAGCGCTCTTTCGAATGTATCAAGCAAAGCTTGATACGCTTGCCAGTTTTGGCGATTGCAGACCAAGACAGACC
ATTTCATGTGGTCTGCGATGCAAGTGATTTTTCCATCGGATGTGCACTAATGCAGTACGACACAGACGATGCTGAGCGTGTCGTCTTCTATCGGTCACGT
CAGCTGCAACCGGCTGAACGTAACTACCCAGTCCATGAAAAGGAACTCCTTGCCATGAAGTATGCTTTGGCGAAATTGAGGGTCTACCTACTAGGTGATA
GACCCTTCATCGTCTACACGGACCATGCGTCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAACGAATGGAAAGGTGGCTTTCGTTCTTCGCGGA
GTATAACTTCTCCGTGGAATATAAGTCAGGACGACTGAATGTCGTCGCTGATGCTCTGTCACGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACT
GGTCCGACCACTGTCGCGGTGTTGACGTCGAGTGTCCCATCGTCAACCTTACTAGAAGACATGCGCAAGGCGTACGATCCGGCGATGGTTCGTTTGATGG
AACATCTCTCGCAACTATCCCTTCAATCCCTTAAAAGGTTTCCCCCAGTATATCGATCCTCCACGGATTGATATACAGTCCACAATGGCTTACTGAAGTA
TACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCATACGGGACCATGGTGACCTGCAACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGA
CATCGTGGTCGAGAGAAGACATATCTCACAAGTTAGTCGCGACTTTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAG
TTTGTCAACGAGTGAAGTCAGGTCCTTCACTTCATGCGCCTTTGCAACCCTTGCCCATTCCGTCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTT
TGGATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTTGATAGATTCAGTTAAATGGTACACCTGGTCGCTGTACCTGAATCTATCAAT
GCATCGGCATGTGCTCATGTTTTTATTGACACGATCTTTCGTCTTCATGGGTTGCCTCGTGAACTCGTCTCCGACCTAGATCCACGGTTCACTGCTGAAT
TCTGGCGATCGGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCTGACCACCCTGAAACAGATGGTCAGACAGAATGTGCAAACCGCGTTCT
TGAGGAAATCCTTCGGGGTTATGTCCATTCGTTTACGAATTGGAGCGAATTCTTGCCAACGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACG
ACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGACTATCCACCTGCTTAGAGTATAACCCTAGTTTGAGGGGGGGAGGGACTC