Description :
From Genome Similarity Track
Location :
scaffold_954:1285- 8606
Transcript NameFunction/comments
g10692.t1 conserved hypothetical protein
g10693.t1 family 3 putative glycosyl hydrolase
g10694.t1 acetolactate synthase small subunit, putative

Sequence
7321 bases(100 bases per row)
GAACGAGATGAAATCATGGCGCCACTCTGCGGCCAAATTCACTTGAGTTGCTTATGTAACCGTACAAAAGATACTTTCATTTCATGTGTCAAAACAGCCC
TTATTGTCATTTGATTCGTTATAAATCTGTTTATTAACTGCCAACCACGTTGCCTTTTGGTTTTAGCCAATCCTGCTCATTCTTCCCCATTTCTCCTTCG
ATATCATGGCGGACAGGTACATTGATGCGGTCGGCTTCGAGGCGTACGAGGAGAACGACGGACAGGAGCTGACACTGAAGCAGCTTGTGAATGCATCAGT
CGACGATGCATACGACGCGTGGATGCGCATGGAGTGGGTCGGGCGTGGCTCGACGCTGAAGCCTGGCGAAGGCCGCGGACTCGTAGGCCATCGCCGTCTC
GTCTCACTCGGCGTCGAGGAGCAGATCTCATCTGCGGGGCCGCCTGACAACTCGGATCGAATCCCTACTGTGCGCTACAGCATCAAGAAGAGCGGGCCAC
TGCTGTTGAGCGACCACGAAGCTCTAGTGCAGTTCGTGGCCGACTCTACGGCACCCGCGTCGCAGCCGAAGACACTCATCCTGTGGAACTCCAAGCTCAC
GCCGTCCACGATCGGCAGTGTGCTGCTCTGTGGTGGATCTATCTCCCGCCTGGTACTTAGGACGGTGCTGTCGAGCTCGTTGCGGGAGATTGCGGCGTCG
TTCCAGCAGAAGTAGGTGCAAATTACTTAAGTATGAGAGCCTTCTAATGAATGCAACGAGTTTTTGATCTTACAGGGACAGTGGTTATTCGTGGTTAAGC
GTGCGAGCTTCCGACAGAGCTATTTACTTATTTACTGGTTCAGGGGCGCACTGCTGGAGCTCTACAGGTGTTGGAAGCAGGGGTTCATAGATAGAAATGA
CGACTAGTGCCAAATGGCAGGCACAGCCTTTTCGATGATGGAGTTGGACAGCACTCGCACATCTTGGTCACGCGACGCCTCGAACGCACGTAGTCGATTG
AGGCCGTCGTGTTGAAGCAGCGAGTTGCAGAACACCGTGAGTTTCGTCATGTCACGATGATCCACCGACAGGTAGAAGCTCAGCACGTCGTGTAGGACTT
TCAGCGCTCGTTTCACTTCGTGAAGGTCCGGTACAGTTTCAATCTTTCCTTTGGAGAAGGAAACGTTTTCCACAAGGGGCGATGACGCAGTAGGTGACTG
GGCTCGAGCAAGGACCGTGAGCTCTTCGACGCAGTCGGCCGGGTGCTCCTGCAGCTCCTTAAGTCGGCCGTTGCTTAGATCCAGTGTGTTGTTTGACAGC
CGTCGAATATTAGCTAGAGCCGGGTTAGAATTGGCCGCTTGCGCCTCCTCATTCGCTTTGACGGTACCAGCGATCTCCTCCTCCAGCTTGCGGAGAACAA
CTCGACGTCGCAGCATGTCTGCTCGTTGGATATTGGCTTGCTTGAGCGCGTCGCTCTCGCTTTTGCGACGTCGGGCGTTGCGTTCCCTACGGGCGATCTG
GGCTGCTTCAACGATCATATCCCGAGACGACGAGACACTGGCTGGAGGCGGTCGCAGTTGCGAGTGTCGCCTCTGCAGCGTGCTCCGGCTGAATCCGTCG
TCGTCGCTGGAGCCGGACTCGATGTCCCAAGCCCCGAGCGACTTGTGCTTGCGCAGATTGATCCGTGCTTGCAGTAGTTCGTGCGAGCGTTGATTCTGGA
GGTGCCGTTCCGAGGATGCGTGCACCATGGCGGCGTACTGCTTGTCCAGGTGCTTCTCGTACTCAGGTGCGACTACGAAGTAGGACAACAACGCTACAGC
CACCACCACGACGCTCAGAACAAGCACCACGAGCTGAGCCTCCGTGTAACCTGCGGCGCCCGCCACCAGAGAAGACAGCTCCTGTGTCATGGACGTGTCG
TTCGCTTCTCCGGTCTCGGTCAATCGTCAACTGGGAGATCAGCGGCAGAAGCTCTGCGGAGCTTATTCGTTGGTGCCGCGGAGTAGAGTGCTTTACGCGT
GTTCCAGCGGGCTTGCGCCGCCTTTCCCCGCCCGTTGCTTGGCGTTTCTTTCTGGGTTTCGCGCTGTCGTAAGCGACCTTGGCAGCTCGAGTCGCCTGGA
TGGCGAGTGTCTCGTGGGTCAGAGAGCGTGTGCGTACTGGGCGATGCTGGACGGAGTCTCTTACTTGAAATGGTCAGCGGCTTGCAGAGCCCAAGACGTT
GTGGGACGGTAGACGCTACGCGATGAAGCGCTGAAGAGCAGTGGAAAAAATGGAAGCTTTCTCTGCCCGACGAATGAGGACATCACTGATAATTGGAGGA
GAAATCCTGAGCCCTCAGTAGCCGGACCAAAGCGGCCATGCGACCCGTGATCTACGGCTGCTGCCATTCTTATCGCTTGATCCATCGCATTCGTCGGGAG
ACTATGAACGCTGGTGCGTTTTTTAACTGTGGCAATCCTAAGCTTGGGCAAGTTGAAGTTGTCATAAGAGTGCAGAATGCGTTCGCTACGCTACATGCAC
ATGTGGTAAGTATTACGTGTACTTGCTAATTAAGCGTTGAGGTAAACCCCTTGTATGGCGTGAGGCGCGACAAGAGCTGCTACGAAGGCAAAGAGGCGGC
CCCGTCTCGAAGTCGGCTGCTTCGGCCACGTCTGCACTGCATTCACCAACACGCCCAGATCCTCATTGCTTTCTTCAGCAAATGCATCAAGACAAAAAGC
ACCAACAGACTCAGGTCGTTTCTGACGCAACATGCACTGTTACGTCTGCTACGCTGCGACATACCGCTCAGCCATGGCCATTTTGCCACTTCGGGGCTGT
AGCTAGTAGTTAACTACTCATCGCTTCACTTGACGGCTCTGATCAGTCAGATAGCACGAAGAATGAAACGCTCAGGTCTGAGGCAGACTCCGTATCTGCA
TCAAGCCGATCTGTGCTGGGGCCGCCACGGTTTGCATTCTGGCTGTGCATATAGCCGCTCTCGTCTTGTAGACGTGGAGTTGTCATCGTCGAACTGTCCG
TTGAAGATGGCAGTAGAGAGATGACAAACTCTCCGGGCTCGGCCTGCCGCTGGAAACCGTGGCCCACCACGTGCGACTTGTAATAGCTCCAGTGTTCGGG
CGTGAGCATGAACTCGACCTTCTTGCTTGCTCCTGGCTTCAGCTCGTCGAGCTTCTTAAACGCCTTGAGCAGTTTGGTTTCGGGCACAGACGCACGTCGG
AACTTCTGAGATACAAACAGTAGCACGACCTCCTTGCCAGGACGGTTGCCGCGGTTCGTCACAGTGACAGACACCTTCAATGTGCCCGTCGTAGCGTGCA
CTTGGGTAGAGTTGAGGTACAACGCTGAATACTCGAATTTCGTGTAGCTGAGCCCATGGCCGAATTGCCATTGCACGGGACACTCATCGAACGGATGACA
TCGCGTATTAACTCGGTGGAAGTACGGCAGGAGTTGCGTGCCACGGGCTGGATACGTAATTGGTAGACGGGCTGACGGATTCACGTCCCCGAATATCACA
TCCGCCAGTGCTTGACCACCCTGCTCGCAAGGCAACATGCTCAAGAGGACAGCGTCGGCGTGATTGTGGGCTCCTTCAAGCAAGCGAGGGCGGCCAGGGA
CCAGAATGAGAATCACCTTGGTAGATTTTAGCTTTGTTAGCTCCTCCAGGTACCACAGCTGTCCAGCGGGTAGAGCCAAACTCCCAAGCAAGTCGCCAGT
CTTCTCCGCATAGTTTGGTTCACCCAACACAATAAACGTATAGTCACTCTTTGCCGCAAGTTTTAGCCCTTGTTGGAAGTCTTGCGGATTCACCTTGCCG
TTAATATCTACCACATCGAGATGATCAACCTTCACTTGCCCGCCTGAAGAGGCTGCCTTCGCTTGTACGGCTTCCTTAAAAGTGACACCGTTTGGAAAAG
CGTTGGAGTCACTTGATCCTTGCCAGAAGACAGACCATCCACCGCATAGGAACCCCTTGTTGTCTGAAACAGGGCCGGTGACAAACAAGTTCGTCGTTTG
TTTCAGATCGATAGGCAAAGTGCTGTTCTGGTTCTCCAGCAAAATAACAGACTCCTGCGCTAACTTCAACGCATCCTCTTGATCCTCGGGACTGCCAACA
GTAGAATTAAGCCCATCGTCTCGTTTAAAGTCATCGTAATAGCCCGACTCCATAAGGCCGAGATCCCGTTTCGTTTCCATAATGCGGCGCACAGATTCAT
CAAGACGACTTTCTGAAAGGAGCCCTTTCGTGACCAGCGACTCGATCGTGTCACCGAACGCCTTCAAGTTGGGTGACATGTTCATATCGAGAGAAGTTTC
TTGCCAGGAGACACGGACAGCCTCAGCCACGCTGGGAACTAAATGGTGCTCATAGTACATGCGGTCGACCTCGGCCCAATCCGAGACTAGCAGCCCCGAG
AAGTTCATATCGTGCCGCAACAGATCAACCAGTAACTTTTTGCTGGCGATCACGGGCTCTCCATTCACTGATACGTAACTCTCCATTGCAGTAAGAACGC
CAGCACGCACTGCAGCGAGAAACGAGGGGGCGTAGTAATTCACGAGTTCCCAGTCAGTGATAACATTATCAGCACGGTCAAGGCCTTCACGGACGTTGGA
GTAGCCGATAAAATGCTTCATACAAGCTGCCACTTTGCCTGAGCTTTGCAGCCCTTTGATCAGTGCGGCTCCCATGACTGAAGCCAACAACGGGTCCTCT
CCGAATGTCTCTAAAACTCGAGACCATTTCGGCTGCACTGCAATACCCAGTACCGGACTAAAGACCCACGGGACACCCGCACTCAATGTGTCCTTAGCAG
CTACAGCGCCCATTCGGTACACCAATTCGGGGTTGAATGAGGCAGCAGCACTGATGGGCTGGGTAAAAAGAGTTGCGCCCTTCACGTAGCTAGCGCCGTG
GGTGGTGTCAATACCATAAAGCATTGGCACTGCACCCTCCTCCTTGTAGATCTCGTGGATCTGCCCTATCACTTCACGATAGTCACTGACGCTCCAGCCC
GTGCGGCCCCCAACAGGTCCCCCTGCGAAGGGGCTGTTGAGAATAGAACCCACGCCCTCACGAGCATACTGAGCTGCTGTCGTCCGATTCAAAGCCTTCT
TGGGGTCCCTCTCGTCCCCGTTCAGCATGGAGTAGATGTCCATTTGCGTCATTTGTGCCGCTTTCTGCCGGATCGTCATCTTGGCGATCAAAGCATCGAT
GTCAACCTCATTCGAGGCGACTGAGAGGTCCACAGAGCCCCGAAGATCGTCAAACACGTCGGTCTGCGGGTCGTACACGAGTTCGTGAGCATCAGGTGCT
ACTGTGGCCGCGAGGGCGAGCTCCGATGCCCAGCACAGCACCAGCACCAGCACGAGATCCTTGGCCACGATCATTTTCTGAAAAGTCGCTGATGATTTGA
GAGTGTATACAAGGTATACATCACCTGACTAAGTACGATCACAATCTTGATCGTAGACTCCACGATCATTTTCTTTGGAGCGTACTTAGCCGAGAATACC
ATTGATGTGTTTGCGCATTTGGTTTTGGTTGCAGGCCAACGAGCTTCAGGCGCCACATTCGACATTCGGCAAGATGCTGCGGAGGTCTGTGCTGCCATTG
GCGCGTCGCGCCTTCCCACGGTCTACGGCTACCCTCGCGCCGTCTAGCGCCGCACCCATGTACTTTTCGCGCGCCTTCAGCGTGGCGGAGCAAAGCCAGC
GCCATGTGATCGCCGCTTTGGTGGTCAACCAACCCGGTTGTCTGGCCGAGATCGCCAACCTCTTCGCCGCTCGAGGTAGGCAAGGATTGTACAAAGCTAA
AAGAAAGGAGGATTTCTAACTTTTCGGGTATGTGTGTTTGCTGTAGGTTACAACATTGACAGCCTCGTGGTGGGCCGCACGGAGGTCGAGGAGCTCTCCC
GCATGACGGTGGTCGTCAACGGCACGGCGGAGAGTGTCGTCAACGTACGGACAGCAGTTTACAAAGGGAAGGTAGATTGGAAGGTGGCTAACAGTTCTAT
TGTGCTCTCTTGTAGATGAAGAAGCAGCTCGAGGACGTCGTGTATGTGGCTGTGGTCAACATCCTCAGCAGCGGCAAGAACGCCGAGAAGAACTACGTCG
AGCGCGACCTGATGCTGGCCAAGGTGTCCACGGCCGGTACGTTCAGTTTGCTGATACTGCTGACAGTCTCACCACCGAAAATGTGTGCATGGACCTTGCA
CTAACTCCTGCTGATGTGCTGCAATGTACAGAGGCTGGATCTCGCGCCGAGGTGGTCGAGCTCGCCAACCTGTTCGACGCCAAGGTGATTGACGTACGAC
CGCACCAAGTGATGGTCCAGTTGGCTGGCACACCTGGCCGCATTGAGGCCTTCCTGGACCTGCTGAAGCCTCTAGGCATTACGGAGATCCATCGCAGCGG
AGTCATCGCCATGGCTCGCAGCACCAGCGTCACTGACAAGCTGGGAGACCTTTCCACTTTCGAAGGCGCCACACGCACGCTTCTAGACGAGGCTGACGAT
GTAGAGGTTGACATCTCCCGTCTTCCTCCTGGATAAGCGCTCAAGAGGATGTCGGTAGCGTTTCCGGTTCACTTTTTTTCTTGGTCAATGCAAACGGACG
TGTGGGCGTGTAGCATGCTAGCGTAACGTCGGCAAGTCGTCATTCTTACTCGTAATCAAGTCAAATTGCAGCCAGACATCGGTGTGGACAGAATGCTTCG
CCGGTAAATGCAGTATCATGACTGAGAGGTTACCAACGCATTTTTCTAAACTGAAATTTCGCATTACATAGCAATATTCGCGGGCAAGGACCATGTGGAG
GCCTGACGACGGCGGAGCAATATATGCGCACTACGCAACACAAGAGCAGCACGAGCATGGAGTTAACGTCTTTTTCGGCAGTGTTGGACGCGGCTGCACG
GGAGACAGCGCGCACCGCTCCCGACGAGGCGAAGCTGCTGGTGTCGAAGATTGAGGAGTAACGCTACTTGCTGTGGCGGCACTGCCGCATCAGGTACTAA
CAGAGTTTGGAGGTGTGGGTAAAGAGCACGGGCGACTAACGGAGTTATGCTACAGACACTATCGAGCCCTCTGGAACATGTACAGGCCGAGATCCTGCGC
AAGGCGACGCAGGGCCTGGATACGGCGGAGGAGTGGATCTACCCGGTTGTGACGGCTCGCTCGAACTCCAAGATTACGCTGTTGGGGAAGGCGTTCGTGG
AGAAGTACGGCGACGACCTGGTAGAGGTTTTGAGCGACGAACTATGCGGGGCCTTGAAGAAGGTGATCCTGACCGCAACGCGTCTGTCCAAACGAGCGCG
AAGGCTGCGGCGGACGCGGAC