Description :
From Genome Similarity Track
Location :
Scaffold_36:128489- 130774
Transcript NameFunction/comments
Hyaar_Emoy2805203DNA replication licensing factor MCM5 putative
Hyaar_Emoy2805204DNA replication licensing factor MCM5 putative

Sequence
2285 bases(100 bases per row)
CTACTTGACGCGCGATACAAACTTATACTGGCTCAATTGTCGCAGAGCTCCCTTCTGTACCATCGCTCGAATAGCTCGCTGAATGGCATTAGGATTGTAC
CCCTGAGCTTCCAAACGACTATACAAAGCACTCGTCTCCACGCGCGTTCCAATCCGCAATGTCCGGTGAATACTCTGCTCCACCTCGTGCGCTTTCTCAT
GAAAGCTGCCAAAAAGTCCCTGCGTCCCGCCGTCCTTGGCAGCGTTCATTGTACTCACACTAAACAGACGAATCGCCTCCTGCACGTGCTCCCGCGTAGC
TTCATTCAGCAACTGCATCTTTGCCAGCGACTCGGAGATCCGGACAAGAGCTTCAAGTTGACGGACCGTCACTGGGATCGTCGTTTCCCCGCCCTGTGTT
CGTCGGACGTCGTCCCGAACACCCACATAAAAGTCCTGCAGCGTCTGTGCGGCTCCAACCGACAGACGGGGCGCACACCGCGTCCGACAGTATGTGAAGT
ATTTCTTAAGTAACCACGGATCAATCTCATTTTTCGAACCAGTCGTTGTTGCCTTCTCATTGGCCGACGAGACGCCAGCGGCGGACGCCAGAGCGTTCGA
GTGCATTCGAACAACGTGCGCCGCCATCTGGCGGTCCCTCGTATCGTCCTGAATGTCCCGCACAATGAAAATCATGTCGAACCGACTCAAAATCGTGCTC
ATGAGGTCGATATTTTCAGATGCGGAGCGCATATCGTCGTACCGACCAAACACGGGGTTGGCAGCTGCCAAGACGCTGGCTCGCGAGTTCAAGATTGTGG
TAATCCCTGCTTTGGCAATAGAAATCGTCTGTTGTTCCATCGCTTCGTGGATCGCGACCCGATCGGATTCTCTCATTTTATCAAACTCGTCAATACACAC
GACACCGCCATCAGCGAGGACCATTGCACCTCCTTCGAGGTAGAACTCGCCTTTGGCATCTCGGATCACCGACGCTGTTAACCCGGCGGCGCTACTGCCT
TTACCGGATGTGTAGACTCCAACAGGAGCGATTTTTTCGGTAAATTTCAGAAATTGTGATTTTGCGGTACTCGGGTCGCCCAATAAGAGCACGTTGATGT
CCCCACGTAAGATCATACCATCTGGTAATCGTTTCCTCGACCCACCGACGAGTAAACACGCGATTGCTTTTTTCATGTTTACGGTATAGTCGCCATAAAT
TGATGGCGCAATACTGGCGGCGAGTTTCTCATAAACATATGGATCTCGCGCCATTTCGTGGAATTTCTCTTCTTCTGCGGGGGAAAACGTTGCTTTGGCT
CGTCCAGCCCCTTCTTCGTCAATTTCAAGACCCACGACACGCAAATAGAGCGTGCGAATGGCAACAGCGCCGACGTTTTTGCTTCCCGCATTGATGACGG
ATGTGATGCCTACAACCGACACGCGCGTGCCAGGTGATGCTCTGTCAACCAAATGACGATCAGTAATCAGCGCCAAGTTGCGCGGCATTTCACCGGTTGG
AACGACTTCGGGATTCTCCTGCAACTTCAGCGTCTGCTGGTCGACGTAATCACCTTTGTCCGGCAAGACTGAATACGAATCATTGGGACACCTTTCACCG
GGCGTTGCCGCATTCTCGTCGTCTCGATTACGGTCACACGAGCGAGGGATACTCACGCCACCCATTCCTGAAGCAGCGACCCGCTTCGTGTGGCCGCAGT
TGCGACATCTAATTGTTGCGGAAACGCACTTAGTGCGCACTCGTGTCGCGCTGATTACGATACCAGGAACTTTCACCAGACGATTGATTTCCTGGGCATG
CACATGCCGGAGAGGTACTAGGGCTTGGTCACTGCTAAGAATAGCTTGGATGTCAGGCAAGTTACCCTTTACTGTTGAAGTTGTATCGGATGATGACGAA
TCACCGATTGCGGCAACCGACGACTCTTGGGAGGAAACGAGCAGTTGCGCCAGCATTTCCTTTGCTGCACTTTCTAGAAGAGGCAGTTGCTCTTTGGGGC
TCTTGAGCAACAGATCTTGTAGCTCTTGGTCGAAAGCTGCGACGTGAGACAAATGCACCGTCACAAACCAGTGGTGGCGACGCGCGTTGGCCAATAGCTG
CTCACGGTAGTAGAACAAAGGACCAACACGGAAACCACGCAGAAAAGACAGCAAGCGATGCTGCAGAGCTGTCGGGCTTGATGTCTGTCGAGCGTCGGAG
GCCTGGGCGGTTTCCATACCCACCGAAGAGATGCGACCCGCATCCCAGTCCATTATTGCTTGTTGTCTAGCTTTGCTGCGAGGAG