Description :
From Genome Similarity Track
Location :
Scaffold_21:128465- 133383
Sequence
4918 bases(100 bases per row)
GAAGAAAAAGAGGGAGAAACCTTTTCTATGGATTCGAGAGGTCTAAATATCGATGAGCGCCGCTATGCTGCAAACCTAGCAGGAAAGGGTTGGCTTGGAC
ATATCGAAACTTGGTGGTAGAGCCAGAGAATGGGCTCTGACATGTGATGCGCATGTAGACGCCGCGTTTTTCATGTGAGATACGCTTAAGAGACAGATGT
CTCGCGTGTCGCACCGCCTAATCAGGCTTATCGAGTGCGTTCACGCTTCTTATCTTCCCAACAAGGGAAGAAGGAGTTATCGGACTATGTCCAAGAGTTA
AGAACTCTTCTTGCTGCTATGCAATTGGATCCCCTTCCTGAGGAAGTCCGTGTGACCATTTTAATGGAAGGTCTCTGTACTGGGGTCGCTCGGACCGAAT
TGTTTCGTGTCCACCCCTCAACCTTTGAGGAGGCTGTGGACATAGCGTTGAACACCGAGTTTAATTTCAAAGAGGCTCGCTATAATACGCATGGGCACAC
CCAATATTTGTTTGATAAGGCTGAGCCCATGGATCTCAGTCATGCGGACGATGACAAAGCAGAGCTTCAAGCTATGGAACAGATATGTAACATCCGTAGA
CGTTACACGTGCGGAAGCACAGGGCATCTCAGCCCCAACTGTCCATTGCATACGCCGCGACAGAATAGGCTGAGCCGTAATACCACCACAAACCAGAAAT
CTAGTACGGTGCGGGAAAACGTTGACTCCCAGTAGGCGCGGGGCGCCCTACTGGGGAGGAACTAGGCTTTGTAGAGGCTCTAGGAGGTAGAGTTGAACAA
GGTTTAGCCCCACATGATCTCGTGGAAGTTGCTACGAAACGTGAATACATGTCAGGCTTGTTGGTTGCCTCGGCAACGGTTAAGGGATTTGAAGAGTCGT
GGTCAATTTTGATTGACTCTGGGGCATCGGGCAACAACGTCCAACGCCGATCCCTTGAAGGGAGTCAGAAGTACACTGAAGCGATGAAAGCACATATAGG
TGATCTTATCATGGTACGTCTAGCAACGGGGGCCCGTGTCACCGTAACTAAAGTTCTGTAAAACTTAGGTGTAAAGGTTTTAGACTCAAAGCATTGAACA
CTGTCTTGTCCTGGATTTGGACTCGAGATATGATCTCATTCTCGGTATGGTCTGGCTGGAACGCCACGAGTTATGGATTGATTGGAGGTCCAAGACCTTA
GGCTAAACGCGCAATGTCTCTAGTGAAGCTTTGGAGAGTCATGAATTAACCGTTGCTAGACAACAAAAGCGCTATTGACGCGGGCCACTGGCTGAATCAA
TAGTGTGCTGGACATCGGAATGTCTGAGTTAGTTGACTCTGATGTCAATGACAATAGTGAGACGGCACGTACTCCGTTGAGTGGCACTTGTTGTAACAAC
GAGCTACTGGATGCTAATAGCATTGATGACCCCAGGTCGAGTCATTTAGGGTGTGATCCCTTAGATATATATGCAGTGGCACGTGAACATCCACAGAGTG
AGAGCGGCTGCAATAGCACCTCACTGGATGTCGGTAATGGCATTGTTGGCGAAACGCCCCAGCAGCAAGAGCGAGGCTCCTCTGATGCATGTGCAGTGGA
ACGTGAACATCCACAGAGTGAGGGCGGCTGTCATAGCACCTCAGTGAATGCCGATAATGGCTTTGTTGGCGAGACGCCCAGACATCAAGAGTCTGATGTG
TGTACAGTGGCGGATAACTCTCCGGGTGATGAGTTCGAGTTAAGTAACTCTGCACCGGATGTCGGTAATGACATCAGCTCTTGTTTAGAGTACGCTAAGA
TTGATAACGCTAATCACCTTGTAGGACCGAATGGTACGCCCTCACTGAGGAGTTTAGTCTCTTTCAGAGACGACAGCGACTCCAAATGGCGGCTACGAGA
CGAAAAGCGTCTCTAATGTCGCTTAGCGATACTAACGATCAGCTATATACACTGGTCTATCGCGTGACAGGTCACGTGGATGGTGAAGTTAGCCTTGCGG
TCCCCCCACCGTTAACTGCTCTGTTAGAGCTAGACGAAATGTATGTAGACGAGTTCAGTCAGGCCTTGAGGGCAGGCGACTTATCCGATATGATGGTCCT
TAGACCCGATAATGAGTTGAACTCCTCGTCTCTATTGGATGAGACGGTACTTGAAAGTACAAAGCGGCACTTAGTGCACGAAGTGGATCATCTATTTTGA
AGAACCTTAAGACCCCTATTACCCTTTGGTAAGGCATTTCAAGACCCGGTATGTCATATCTACCGTCTGTATTACCTTCCTATAGGAGCGTACATCATGA
AATTGACTTGGTTCCTGGAACCAAATACTGCGTTACAAGGCAGTGGCCTTTACCAAAGCAACAATGTGACGTCATTGACGAGTTTTTCTGTGCTAAGCAC
GCGGCGGGAATGGTGCAGGAGAGTAAGTCTCCTCATTCCACACCGACGTTTTGTGTCAAAAAACCTAATGGTAAGTGGCGTATTGTACACGCTTATAATA
AGCTCAATGCGGCTACTATACCGCCACAAACACCCATTCCTAGAAAGGACGTTCTTCAGAACAACATGGCAGGACGTCGATGATTATTATCAACTGCTCA
TGCGAGCAAGTGATATCCCGCTTATAGCGGTTAGTGGTCCAAGAGGTATGCTTTGGGAGTGGCTGGTTATGCCCCAGGGACTTTACAATTCCCCGTCTAC
GTTTAATCGTCTGGTGACGCAATTTTTCCGCCCTCATCGTGCGTATGCACGAACATATTTCGATGACATATTTGCCCATATTCGGGCGGAACAGCGTCGG
TCGGACGTGGATAACCACATCGACCATTTACGAGCTGTGCTCGAGTGCATGTGCACTAATAAGATCTATGCTAATGCATCAAAATATATCTTTGGTGCGG
ATGAGATCCCATTTTTGGGATGCTTCATTGGGAAGCGAGGCCTTCGGGCAGATCCTGCAAAGGTGAAGGCCATAGTGCATTGGCCAGTTCCTAAGAATCA
AAAGGACCTACGCCAATGGCTTGGCCCTGACAAGTATAATGAGAATTACGCTGATATGGCTCGACCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGG
TGCTCGACTAGCACAGAAGCAGAGGCTTTAAAAGCCGTAAAGGAGAGTCTCCTACATGCCCCGATTTTGGCTTTGCCAGATTCTGATCTGCCTTTCAGTG
TCGTCTGTGACGCTTCGGATTTTGCCATTGGCTGTGCTCTGTTACAAACAGATGTTGAGGGATGCGAGCGTGGCATCGCTTTTAAATCCCATCAGCTTAA
TGCTGCTGAAACGTACTATCCAGTTCACGACAGGGAGCTACTTGCTATGAAGTATGCTCTAGTCAAGTTCAGAGTTCATCTGCTTGGATCTAAGCCTTTT
GTAGTCTATACCGATCGTGCGTCTTTACGCACGGCGACCCAATAACCTCACCTCTCGCAGAGGATGGCCTGTTGGCTTTCATTCTTTGCAGAATATAGCT
TTAAGGTGAAGTATAAGCCGGGAAAGCAAAATACGCTAGCTGATGCGCTGTCACGACGGCCCGACTATGAGCTTGCTCATTTTACGATTTTGTCGTCGTC
AATTACTGACTTAATCCGTGCATCTTGTGCCACGGATGAACAATGTGTAGCTTTGATACGTGCTCTTGGAAGCGATGAGTTCAAAGACTAGAACATTAAA
TTGTCGGCACGTTCGCGTGCGAGGCTACATCGATATTCTATCGATAACGGCTTGTTGTATATTGCACGGATACCGCGGATACTCCGCGTATCATTATTCC
TCATGATGAGGAACTGAAGTATCGTATACTCTGTGAGGTTCACGATACAGCTATTAGCGGTCATCTCGGTCGTGAGAAGACCTACGGATTGGTTAGCCAG
AGTTATTGGTGGCTCAAACTCTATAAATGGGTAAGCACTTATGTGCGCACATGTGAGATGTGCCAACGGGTCAAAACCTCGGCACATGGGGCTGCGCCGC
TGGCTAATTTGCCTGTACCCTATGGGTGTTGGGAGTCCATCATCATGGACTTCGTGTTTGGCCTACCAAAGGATTCGGACGGCAACACAGTCGACCGTTT
GAGAAAAATGCCCCACTGAGCGACTGTGCCGGATTTGATTGATGGTGAAGGTGCAGCTTTGCTGTTCATTAATCGCGTGTTTCGCCAACACGGACTGCCA
CTGGCAATTTTCTCTGACCGCGATCCTCGTTTTACGGGCAAATTCTGGAAGGCCATCTTCAAGGTGCTCGGCACCAGATTAGACATGTCTACCGCGGATA
ATGCGCAGACCGATGGTCAGACTGAGCGTGTCAATCGTGTCCTCGGTGACGACTCACGCAGCGTGTGCGCTGAGATGCCTCGACGTTGGATCCCAAAATG
CTCCCCATAGTTGAGTTCGCCATGAACAATGCAGTCCATGCCTCGACAGGCTATACTACGTTCTACGTGAACGGCCTCACCCACCCAAGCGCTCCGTTGA
CACTGCCACTGCGTGGCTCAGGACTTGATGGGGGAGAGGTAGCCGATTGGCTTGCTGATATCAGCCCTTCTACTGTTCTAAAACAGGTTAGCGCGTTCCT
CACAACGCGATTGAATGTCTTACGACATGTTCGTGACGCAATGGCTGATAGCCAAGACAAACAGAAGGAAGAAGCGGATGCTAAAGGCAGAAGATTTATT
GAAAGTTATGAGGTCGGTGACCAAGTCTTACCAAACGCTAAAAACCTATCTACAAATGTTGTGTCTGCTGTGTTAAAGACTAAGCTGCTTCCTCGCTTCA
TTGGATCATTTACGGTCGTGGTCAAGAAGGGCCTTGCGTATACGCTCAACTTACCGCGCAAATTGCGTACCCCCCCCCCCGTGTTTTACGTTGGCCTCCT
TAAGCCTTATCGGGATCC