Description :
From Genome Similarity Track
Location :
scaffold_60:128424- 152969
Transcript NameFunction/comments
g6706.t1hypothetical protein
g6707.t1hypothetical protein
g6708.t1 hypothetical protein PHYSODRAFT_474162
g6709.t1hypothetical protein
g6710.t1 hypothetical protein PHYSODRAFT_309443
g6711.t1hypothetical protein
g6712.t1hypothetical protein

Sequence
24545 bases(100 bases per row)
TAGGCCAGCTAAATGGGAACGCAGTGAACGTCAGCAACAAGATGATACACTTTTGGGGCGTACGACTTGACCTTCTCCACGTGCTCGCACGTGATGGTCC
ATTGCTTATCGTACTGCTGAGCAAGTTCGCGCATCGTATCCACCACACGTTGTTCCCACGCTTCGCGATCCTCCACAGCCACGTTGTCGTGAACGTGGAA
CCAGCCACCGCTGGGCTTCAGCACTTGCACAGCCAATGGCCAAGCCTTCTCACTCGTAGGCAATAGTCCCAGGTTCACACGGTCTGCCACGGCTCCGATC
GTAGGGGCCGACTCGCGGTTGTCACCGAGGTACACCTTGCACCTATCTGCAACATGGTTGCGCTCCAAGTTGAAGCGCAGAGCTGCCACTGAGTTCGGAT
TCCACTCGCAAGCGTGGACAAACGCAGCGCCTCCGTGCACAAGAAAAGGTAGAACGTAGTAACCAATGCCACAGAAGAGGTCCACGATCGTTTCCCCACG
GCACCCGATGGTTGCCATGCGAGCCTTTTCGGTGACGTTGCCAGATGAAAACATAACTCGCGTAAGATCCCAGCCATAGACGATTCCGTTCTCACGAATC
TCCACCCAGCCCGGGGCCTCTTTGCTGCGTTGAGAGGTAAGAGCCTTTTGATTTATGTACAGCAGCTCCACGTGACTTTGACGCTTTTCACTCGCATCAA
TGAAGGCCTTGCGTGCAACACGAGAGAATGCAGGCGAGGTGGACGCACAAACGTGTGCCCACATTTCGTATGCGAATGGTGCCCACTCTGGCTCCAAGAA
GGAATCACGAGGGATCAGCAAGACGTCGCTCACGAACTCGTACTTCTCTGGAATGGCCTTCACAACCTTGGCAGGGAGTCGATACTTGCTGGCAAATGCG
CCGATCATACTGCGGATCGCCTCGTTGCGGTTCAGCCCACTGGTCTTTCCAAACTTGTTTGCGTACGCATCGTCATCTTTCACTACCTCAAGCCTTTGCA
GTCCAGTCTCATCCGTCGAGGCAAGCAGCTCACGAATAGCTGGCGTGACAGGAAGAAGGAACACAGTCGTTGGCTTGCCTTCGCCCATAACCTGGCTCGA
TTGTGCAGGCGTTGCAACATGAACACGCCGGGACTTGTCGTACACCTGTGCCCTCTCCAACAAAGTCTTCACCTTCTTCACTTCTAATTTTCCAACGAGA
ACACCTAGCGGCTTGTCATCCGAAGTGGGCAGCACGCTTGTAGAAGGGATATTCGCTGAGCTGGCCTTGACAGTGTTGACAGCGGTAATTTTAGGGGCCG
CCAACGACAAGTGACACTGAAACACCGAAGAGTAGAATTGGCCGAAGCCAAAGCATTGGAAGCCACCGCCTAAAATGTAAAGCGATTTGTTGCTCGGAAT
CCAAGTGGTGCTGTGTCCCACAAAAGCAGCATTTTCATGCTTCAGTTCTCCCAGCTCCGTCCACTGCGAAGCCTCGACATCCAGTTTATACACTTTTCGA
GTCGCCTTGTCACCATTTGCAAGCAGAGCTGCAGTCATGCCGCCTACCACAATGACTGAGTGATCGCTAATTGAGGTAGCGCTAGCTGCAAAAAGCGCTG
GCGGCTGGCTTTTGTTACTGCCGTTCTCGAGAACCTTGCGTTCCCAAGTCTCCCCGACAGTATCGAAAAGCATGCACACAGCGCTATCGTCACCACTCTC
GCCGCTGCCATCCACGCCATCCAATGATGACATGCCTCCCCAGAAGACAAGCTTCGTCGAGCTGACAGCCACACCAACGTGATCAAAGCGGTGCGGGATG
CTGGACGTACTCTCTGCAGACAGAGAATAATAAATATTTAGTACACTCCGAAAAAATGGAGTAGGCTTGGAGTTTGACTTACCGATTCGACGCCATTGCG
GCGAGTTCTGACTGAGATCTAAAGAAAATAGATCTCCGAAAACTCGTTCAGCATCGCGGCCACCGTACACGTACACAACAGAGCCAACTGCAGTCACACC
AACACCAAGCATGGACAGAGGTTAGAGCACTTTGTGATTCCAATTCGTCAAGTAAGAGCTTACCAGCACAGCTGCTGTGCTTCCAACGTGGAGAGGGGCA
GACTCCTCGCGGATGAATCTGCTCCCACAGCTTGGTCTCAATATCCAACGCATACAGGTCGCCCAGGGGTTTCGCGGGGCTAGCACGACCACCAAATATG
ATCATGCGCGTTCCTACAACAACAGCGGAATGGTGCATCCGAGCTGATGGACCAGTAGCTCCAGCGGCAGCGTGGTACGTTTGCTTAAGAGAACCGTCAC
TTGATGGTGCCAGAATTGTCACGTCCGCAATGCGCGTCGTCGTTCCTGACGCAGTCGGTCCCTGTCCACCGAACACAATAATGTTGTCCTGATACTGCAC
ACTCGTATGCCCCACAAGCTTGACGCCGTCCTCGTTCGTCACCTCCGTCCAGGACCTCAGTTCAACTGAAGAACCACTCCCAACTTGCTTGCTCACTGTC
GGCTGGCAAAACTTCGCGAGGAAGGCGTCAAACAGTCGGTCCGTCTTCTGCTTATTCGCCTCAAACTTCTGGTTCGCGACATCCACGATCCATTGGAGGT
ACTCCTCGTCCACCAGCAACTGCTGCGCACTGCGTCCAAGCGGAATCTCTAATCCGTTCGCGGTTGTGCGAATCGCGCACATAATTTTCCGGTTACCAAG
CACGACCCCCGATTCGCGGAATCCGCTGGCGATGCCCCACTGCAGCAACTCCTTGGCCGCATCCAGGTCGCGACACACCACGTGCATGATGAACGGCTCG
TGCTTGAAAATAACCTGCAAAAGGCACAACAACCATCAGCTCAACACCATAAAAACAACCTAAAAGAGTAAAAATCGTCAAGTGTCAACCATGTTGCTGG
TGCTGGAATTGGCGTCGGGTGACTGCAGCGCCGCCTTCAGTTGGTCGAATGTGATGGTACTATGTTCGGCGATCAACCACTTGCCGCCTTTGGTGATCAG
GTCCGTCGTCGCTTCATTCCCATTGCCCGTGGCCGCTTCACCGCAGAAAACTGCAATTCGCCCCGAACACGAGCTGCTCGTCACCTGTAGCAACATGAAG
AACCCAATAAATGAGCCCAATTTCCAATTGCAATTGCACCAAGAATGATCACTCACGTAATTCGGGTGGTCGTTGATACTCTTGATCATGTCCACAATGG
GCTCGTCAATGCAGCCCTTGGGGCTCTTGTCCTCCATCGCCTGCAGCTTGCGCAGACTCTCGCGCTTGAGCTGCGCGAACATCGTCCAGCCAGCCACAAA
ATGACCGTCACAAAACCGTCATCGAATTTATTTTCCTAAGTACGTATCAGAATTTCCATTTTGAGTATCTACTCAAAAACTTTCCCTGCATCATGGCCGA
GCCGCGTCTCCGCGTGCGTTGCGCCGGCGTGCGCATGAACCAGCGCGGCATGTCCGACAGCGGGCACGTGTTCTTCAGCGAGACGCAGTACGCGCGGTCC
CCGTTTCTCGTGCGCGTGAGCTTCGACAGCGTCGCCTTCGTGCACCGCGGGACGCACGTCGTGGAGCGTCGCTTCGACTTCCCGACGCGCGTTTTGCACG
CAGTGCTGGCGGACTTCTCGCCGCAGGTCCTTAACAATACAATTCACCAGTATGCAGGTGCGTCGCTGCCCCCAAAAGCGCGGAATTCGCCGCTCCATCC
CCGGACGCACCCGCACCTGTGCGTTTTGGTGCGCTCCGACTGCTTAAACATCTACACTGCAGCCGGACAAGTGTTCGAGGTGGCGCTGCCCTTCCAGGCC
AATAGACTTTTCCCTATGGAAGGCCGTGGACTGCTGCTACAGCGCAGTCCGGCGGCACAGATCCCGCCCACGGCTTCGAAGCGTCCGCGAGACGCGGCGG
CGGCGGCTCTGGCCAAAAAGAACCGGCGAGCGAGCACCAGTAACAGAGGAGATGGAGACAGGTACAAGTACAGTGCTGAAGACGATGGTACGCCTGCGAG
ACCAAGGTATTTTACGCTCAGACACCCGCTGGATGAGGTCAAGCCAGTGGCGAGCAAGAGTGAGGAGGAGTTTCTGGCGAGCTCCGCGTTAGAAGCCGTT
GCAGTGTTGGTGGAAGGAGCGTCTCTTGTTTTAGTGGCTTTTCATCGCTGGGAGCAGAGGTTTTGCATGTTTCGACTGAGTGAGGTGGAGAGGAGTGGAA
GGGATCAATTGATGCCGGAGGTGCGGGTGGTTGATGGACCCACGTGGACGAGATACCGTGCTAGGATGGATTTGGAGGAAATACGGGTGCCGATTGAACC
CGAGTGGCTCGCGACGCCCGTGTGGAAATCTCCTCGAGTGGGACCCGCGACGTCAAAGCCGAGGTTTCTGTCCTCGATTATTTCTCCGCCAGCGGCTTCA
CCTGCACCGCCGTCGCCATTGACGGCTACTCCGTCGGTTTCGTCAAGGAGTGATTCGAAAGTGGCTTTCATTGCGTCCGGTGTTGATGGCTGCCCTTTGC
TCTGTATGATGGACAAAGGGGTTGGAACGCTTCTTTTGAAGCCAATCTCGCAGCAAGAAACTGGTACTGCGATGCTGGCTGAAGGTGACGGTGAAGCTGG
TGGTGTTCGTATATTACACTGCCGTGACGCTGTTCCGATCTGTCAGCATGCAAGGCGATTTGAAGGTGGAGAACGTTCCACAGACAATATTCCAGGTTCC
ACCGATATTGTAGTTCTAGAAAAGGATGGCACGCTGATGTTATATCGAGCACACCGTCCTGTTTGTCGCCTCGATCTTCCTGCTGTGGAACAGGATTGCT
TCGTTGGCAGTGCTGCAAAAGATGGGGCTTCGGAAATAGTACGGCTGATGGGCAATGTTCAGCTAAGCTCAATTGACCGAGGACATGCGTACGAGCTCGT
GTATCCGAATTTACGCAGCAGCAAGAGCGGAAAGATTTGGCGGTGCGAGCACCCGCTGAAGGTTGTGAGCTCTCCTCTTTTGCAGCAGGTTTTCGATGTG
CTGGATTGTATAATCCCACCTACAGAAATGTGCGAGTTTAAAGCACACGTGATTTATCGGGCTCAACAAAAGACTCAAACAAATCGGAAAGATGATCAGC
TTGCAAATGGTGGGGTCGAATGGCAATCTTTTAAGGAGTGCGTCATTAATATGCTGGAGGAAAATGCTGAGGGTAAGCCAGCAGCAGGAGGGACTGGAAA
CGACGAGGAAACGGCAATCTCGTGTTTTGATGCGCTTTGCCAGAGTGAGTTTCATGGCATGTATCAGTACGAGCATGCAATGCTTTTTGCCACGATGGAG
CTGCCCATCGTGGAGTCAACGACAAACAGATCTCCCGAAAAAATGCATACTGACGACATGCGCCAGTGTCAAGCAATGAAGAAATACTGGGAGACAATGT
TTGCGGGGCTTCATTTACTCTGTGAAGACCTGAAGTTGTCGATTACACTTGTTCAGCAACGTCTGCAACTAGTGGACATGCTGATGGAAATGTCGTCACT
ACTGCGTTTGGATTCCTTTGCTGCTTATTACAAGAAAGATAACTCTGTGCTGAGACGGCAAGCGAATATGACGATGGAATTTCGATTGCAGGCACCTACG
CTTGGAGAGGGGCTACTTCGCTTTACTTCCTACGGTTGTGTGCCGGACTTGGTTCTGTGGCTACAGAGCAAGATGACTGCGAAATCGCAGAGACTGGCAG
CGTTTCCCATGTTATTGGAGGATGATGATCCGCGGCAGTTTTCTAGAATTTCTCCAGGACGTTTTGTAGGCCCCTTTCGGAGGACAAGAGCAGTTTGTCA
CGCATACGAGCTGATGTTTCCAAGCTCAGAAGAAAACGCGCAGACAAAGGCTTTCAACCTGATCGTTTACCTCAGTCAAGACCCCATCGGTAACGCTCTG
TCTCTGGATGATCTTCCGGTAGGTTTAAGTTTTCCGATCGTGCAAACCATTCGCCACGTGAAGCACCACCCACCCCCTTCCATCACTGAAGACGTGAGCG
CATTTGTGGGGCGAGAGGATCTCAGTATTGCAAGTGCGGAAAGCCTGGCAGATCATGTTGACTATTCGACACAAAACCAGAAACAGCATGATCCAAAGAG
TAAAAGTCTTGATCTCACTGAGGACGACAGTCACGACGACTGCGACGGTCTTGAAGACATTATAAGTCGGAGTCAGCCCCTCTTCCCTACTGACCAGAGA
ATGAAGGAGGTTGCACGTTTGCTTCGTTCAAGTCGCCCTCTCTGCCTGAAATTAGAGAAGACGCCGGATTTGTCAGACCTGGACTACGCGCAACAGCAGC
AAGCCCGTTTGTTGCTTCTCTGTAAACGGTCTATGGCGCTGTCTGTGGCGCGTGGCATGGTCACACTAGGCAGTTTTGATGTTTCTGCCGCGCAAACGCA
GATATGGCGACTTTCTATACCTGCATTGCCTCTAGTGGGTCGTAAACCGCCGGCAAATGCGATTGTGGAGCTCGATCTTTCCGGCTACGCCAAAGAATTG
ACGTATTGGCCTCAATTTCACAACGGCTGTGCTACGGGTCTACGGCTTCCAGCGCATGATCTCTCGGGCGTCGTCAATCGTCATTGGATTAAATACCATC
GACCTTCAGTGAACGATGCTCCACAGCGAAACCCAACGGGAAGTCAGCAGGCAGCAGCGGTCCAGTCGGTTGACTCTGCCGGCCGTAACCTGGAAGAGGC
ATACGCAGCTCATGCAGGGTTATTGCTGGGAATTGGTCTACGCGGTCACCTCAAATGCTTGTCCATGGCAGATGTGTACAACTACCTATCGCTGTCGAAT
GAATTTGTGACTGTGGCGATCATGCTCGGTATGGCTAGTACCGCTGCTCACTGTCGACGCAAGCGAAAGCAGAAGACTGCAGCAGTGAAGCCTACCATGA
CGGACGATGAGCAAGCAAGTGGAGACACGGAGGAACCATCGCTTGGCGCCGATCATCTTTTTTCAGGTTTCCCAGAGCTCTCATCATCCGATAAAACTCC
GCTACTCGGAACGGGATTAGAACTGGCACTGGAGCGATCAGTATCCAAGATGTTGTGTCTCCACGTTCCATCGTTGCTACCACCACCATTCGGAGGGTTT
TCAGTACCTGCATCCACTCAGACGGCTGCATTGTTGGGACTCGGCATCTTATATCAAGGCACGGGTTATCGCCTGATGACAGAGTTATTGCTTACGGAGA
TAGCGCGTTCTCCATCAAGCGCCCAATTCGCAGGGAACAATGGAAGCGCGGGTCTGTCAACAGGTTCGTTCGATCAGCTGGAGGGTTACGCTTTGGCAGC
AGGAATGGCGCTAGGCCTTGTCGTACTGGGGCGTGGTCAATCTACAGCAGGTGACCCAGGACTGGCTGACTTGAAGCTTGAGGAGAAGCTTCACAAGTAC
ATTGTCGGCGGAGCCCAACAGTATCGGGATACAAACGTGGCTGGAAGCTGCCTCTATCGTGGTCGCCGTTGGCAGGCATTTGGCAGCGGGGGTAATGGTT
TCAATTACGCAGTAAACGGCAACCCCACGGCTAACGACACGCCTAACAGCAATACCGGAGCTTCTCCTGGCGCTGGCCGTGACGCAAAACACGTGAACGA
CCGCGGCGGGGCTCGTGGCGGTGGCGAACACGTTAACGTTGGAGTGACTGCGTGTGCAAGCGCTCTGGCACTAGCATTCATGTACATGCAGACTGACAAC
AAGGCCGTGGCTGCGCAACTGGTAGTCCCCGACACGCTTATTCTGCTAGACTACGTTCGCCCTGACATCTTGCTGGCCCGCACCCTAGCAAAGAACCTAG
TAATGTGGAGCGAGATTTCGCCAACTGTGCAATGGATTGACCAGCACGAAGTCCCAGTGCAGCTACTTCAAGCATACAAATTTATCCAGCCGCAAGCAAA
TGATGCCAAGGGGCAAACGGAGAATCCTAGCGCCTCACCAATGCACTCTGACCTCCACTCAATTTGTGAGGCTTACGCGAATATTGTTGCAGGGGCGTGC
ATGAGCATTGGGCTGCGGTTCGCCGGCACAGGCAACGTGACCGCTCGAACTACCCTTCGCAAGTATGTTCTACATTTTCGGGAGTTAAGAGCGAAATCGT
CGTCGTCTTCTTCCTCGATGCGTCTGCGAGGTAGTAACAACGTCGTTGCTGCTGCGACGGAACGTGCAACTATCGAGAGGTGCTTAGCTGTGTGTGCACA
GGCGCTAGCCCTGATCGATGCTGGAACTGGCAACATCGAAACGTTGACACTTTTGCGCTCGATAACATTGAGGCAGCGCGTTGATGCGGGAATGAGCTAC
GGCAACCACATGACACTCAGCATGGCGATCGGGTTGCTTTTCCTCGGTGGTGGCCGTGCCACAGTTTCACGATCGAAAGAAGCTATCGCGGCGCTCGTAA
TATCGCTCTACCCGATGCCGCCGATGAATACGGCTGACAACAAGTATCATCTACAGGCCTTCCGCCACCTTTACGTGCTAGCGGTGGATAATTCTCGATT
GCTGGAGACTGTGGATGTGAACACTAAAAGAACCTGTGCTGTCCAAGTTCGAGTTGATCTTCATCCTGTCACACTTGGCTCTAAGAGTGAAACTCAACCT
ACGTGCAAAGTGTTACGCAGCCCGTGTCTTCTTCCGGATATTGCAACAATCAAACGCCTCGTCATCTCTGAACCGGATTTCTACCCGATTGAAATCCTCA
CTTTGCCGCCGTCTGAAGAGCCAATGTCTTTGAAGAACAGCAACATGAGAACGGCCAACGCTCTTCGGTTGGAACTCTTACAAAACAAAAACTTGGTTTT
TCTGAAGCGGCGACAACGTAAAGACTTCGGGGGTCTTGTGGATCTCCAAGAAGTGCACAATGGACACGTGACAGCCCGGGGTGGAGGTAACGACGACGAT
AGAATGCGGAGACTCTTTCGGTCCTACTTCACGACGGGCAATAGTGGTGACGATGATGACTGTGAAGACGGCGAAGATGAAGCGGGTCAATTAGACGTGG
TTGATTGGGGAAGTAGTTGGTGGGCATCCCAGTTAAACCCACGAGGACTGGAATACGTCCGAGAAGAGGCACAATTGCTTATGCCGCCATACTTGAACGC
CTTGCATGCGCTCTTTCGGCTGCAGCTAGTGCCGCAGTTAGCATGCGCCACGGAGATCGTGACGTTGAGTCTGTTCAGTGATTACTGCCGCCTGCATGCA
TCATCTTCAGCGTCAATAACCAAGGACCCGGTCAGACTGGAGGGAAAACCTTCATTATCCGATTTTGGCGTTTGGCTCTCGAATCAAACCGAGGAGGCCC
TAGGAGCACTTTGGCATCGAACGTCGCTGTCAATTACTTCGCTGGCTTCTGCGCGAGTCAAGCTACTAATGGAAACCCCATCATCGGCATCACCGACGAA
AAGAGCCCAGTCACTGGCGGATGAATTCTTCGTCAGTGTTCTGGTGCGCTATTTTGCAGGTCCGTCGGTGTCGTCACTGCCACTTGCAGAACAACCCCAG
CGTGCAGATAAAGATTGGAAGGCCAAGTTTCAACGAGTACTTGCTGCGTGTTCACAAGCTCAATCTCAATCGCTGAGCATGACTTCGGCGCCAGCACGAT
TCCAGTTGTCAGCATTCCTCGAGCAGAATGAGCTTACGGAAGCTGAAAAGACTTTCTGGCTGAAGTTGGTATCGTTCTTCCTATTTTCCAACTAGCAAGT
GAGTGCAGTCGCAGCAGGTAACTACCATGTATGCATGAAAAGACTGGGTTTTGCTAGTGTTATTTAATTTTTATTGTCTTGCAGGCTGAGCAATGGGAGC
TGCATCAAGATGACAGCCACCTCTATGATCCACCTGCAAGTGTGTTTCCTATCTATTCACCCCGGGTCGACGAGAAAGAGAGTTCAATCTTCGTCAAAAC
CGGTGACGGCCACCGCCTGCAGTGTCTTGTCTGGTAGCGCTTCGTCGCTGTCGTTCGCGAGCCTGGAATCATGATCATACGCACATGAGGCTGCTACTCG
CTTCTCAAACAGAAAGTCTGTTCACACTCACCATATCGCCGTTCTGCACGCTTCATCATGGTTGTCGAGGAGTGTCCGCGCAAATCCTCGCTGCTGCTGC
TACCTCTTTTTTTTCTGTGGGGAACTATTTTCTCTTTTTTTTTCCATGGCATGGTGTTCCTCTTTTTTTTTTTTGCCACGTTTCACCCACGCCACTACTG
CCCCGGGCACAACCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTCTTGCGTGGTGACGACACGGCTGGGGGGGCCGCCGCCTGCTCCA
CGGGCTTCTTCACCACCTTTGCGGGAGGTGAAGTAATCCCTTGAGCCGACGCACCATTTGTCGACGTATTGGCAGAGTTGTCAGCAGCACCCAACGATTT
CCCGTCCGGGCTGCCGGATTCAACCACAGCCTTGCCATCGCGATCACGCTTACCTGTAATTTCTGGAGACGCCGACGACACCGTCTTCTTCGGCTTCACA
GGAGTGCTGTGAACAGAATCAGTGCCGTTTGTCGCCTCACTCCCGTCAGCCGCAGGATTCGGGCTACCTGGTTGCGAAATACTGCCCTTTCCATTGGCCA
TCTCGGTTGCAAGTGACGCTGCCTGTTGACTGCTGCTCAAATCCTCCACTCCATCCTCTTGTGAGTGCACACCTTCATCACCCGAAGGCGGAGGGCTTGG
TGCCGCGACCTCCTCGGCCTTCTTCTCCTCTTCTTTCTTTTTCTTCATAAACTCACGACGGACAACACGTGCAACAGCGCGTCCACCCATCTCTTCGAAC
ACACTCTCAGGCAAAGACTTCCAAACAACCGCAGTAACTCTCACGTCCATGGTCGCCGTTCGTTTGTTCCAGCGGTAGAGATCGTTGTTCTTGAAATACT
CCACCGAGCTGTCAATGCTCACTTCACGACTGCGCAGCTGGCGACGGTCAATATCAAAGCCCACGTAGAAGCAGACGCCGAACTTGCTGGGCTGCGCTGG
GGTTCCGCCGTTAGACTGCTCATTCGCTGGAGCCTCACCACCTGTCACAAAGTTCAGTGGGTACTTCTTCGTGAAAGCGCGCAAACGGCAAAGCGCCGGA
TTGTAGGCGAGCGACTCCACCAGCTTACGCATACGAGACTCGCAAAACCCGCACCACGCCTGCTCCTCGTCCTGCTTCTCCGTGTACACCTCGACTGCGA
GGTAGTGTTGGTGGACGGCGAAAAAGTCCGAGGGCTCAAAAAGTGGCCCCCATTCCGAACCACCTTTGCTCAGCACATCTTGCACAATGGTCAGGCCGCG
CTTAAACTCCTCCTTCATAACCGTAAGACTGTGCGTCGACACGTTAAACGAGGAATTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGGTAT
CTAAAAACACATGAGCAATCATCCAAACTCAGTTATTCGTCTAGAAAAAAAAGCTGACAGCAATCTAGCCAACTCACCGGTTGTGGCCTGCGTTGGCGTT
CCAAATTTCCAACCCCAAATTGGCGTCCTGTGTCTTGCACAACTGGATAGCGAGCGGCCACTTCCAGTTGTTCAGCACCATGAAGAAACGCAGCAGCAGT
GTCGACGGAGCCGCGGTCGGGTACAGCTGGTTGATGAAGCACACCAAGATGCACCAATTGACACCTCCGAGGTAGCCCATCTTGTTCGAGTACAGTCCTC
GACGTTTGGCCCAGCGTCTCACAATACGGAGCACGCCGATGAAGCTCTCCCGGTTCGGGGTGAGCTTGATCATGAGCTCCGTGACTCGAGGGCCATTGAG
ACTCTTCTCGGTGGCGGGGTCCACGCCCACAAGCACATGGTCGTCCAGAATATTTAAATTTTCAGGGATTGAGTTCCTCGGCAGGATGGCAATTTGTAAA
TCAATGTTAATCTCCTCGTAGTCGAACGTCAGGATGGGCACGATGGCACCCTCAATAGCCACGAGGTTCGAGACCTTGGGGTGCTGCAGGAAAATGTCCT
TCAAGGACGAGAAAAAGTCCTCGCGCGTCACGTGGCGCGGCGCCACGCAGATGGTGTCGATATCCGCGCCCGGTTCGTTCACCCCGAGGCGGTACGAGCC
CGACACGAGGATCTGGCCGCCGGCGTCGGCCGCCATGTCCTCGGGCACGCCCTTGTCCATGCACACGCGCTTCACCCATTGGCGGAAAATCGAGCGCAAC
TCGGCCAGAATCAGCGAGCGGCGCGTGATGTTGGCGTCGGATTCCGTGGGGAAGTGCGCGTCCATGAAGCTTTGCAACTTGGCCGACTGCTCCAGGTCCT
TGGGCTCGGGCGGCGTCGTGCGGATGGCCTTGTACGCCTGCTCCAGCACGTGCGGCGCCACGGTGAACGTCGCGCTCTGCATGACGAGAATCGGCGAATG
AAGGCAGCCTGTCCGCAGTCCGTTTCGCGCTAATCTGCTTGTGTCACTCAAGGTGAACAATGCCAGCGCTGTCTCTGTGTCGCTCATTGGCGGATAAAGC
TTCTAGATTTCATTGGTGGAAAAGAAACATTATTTTATCGACCAATCAAACAACATTTGAAATTGAATTTTGAATTTGCAGCACTTCTCGTGGCCGAGAT
GGACGACATTGAGGCGCTCATGCCCCGCACCAAGTACGTGCGTGTCCCCCTGGTGCTGGGGGATACAAGGCGATAATTGCTGATATATTGTGTGTGCAGA
GCGGCTAATGACCGAGCGCCAGTGGATGGGGCCAAGCTGCGACAGTACATGGCCACCGCCAACACTGAGCACGTCGGAGCGTACGGAATCTTGCGGTCAT
TTATCGTTTTTTATTTTCTTATTTTATGTTCATAACATTGTAGCCGCTCCGGTGTCGTGGTGCGCGGCGATGTACGCAAAGACGCTGAAGGGTTCGAGGA
CATTGACGACTTTTGGGTCGACGAGGACTCGCTGCAGGACGACTCGGTGGACGATGACGATGACTGTGCGCGGCAGTGGCTGCAATTTGCAGGAGGATAA
GAGATGCTGACCCTGTTTTTTAATTTTATTTTGACAGCACTCACGGTGTCCGATAAGGATGAGGCGGATACGTCGGGGGACATATCGGAGCCGAGCGAGC
ATGAGGTGGAGCTGCCGGAGATTGACAGCCCCGTGTCCAGTGGCAAAGACAGTATAGACATTGAGCGAGGATCGATTCCAGCGAGATCGCAAAGAAGCAG
TGACAGAGGGATTTTGGATATTGAGCGAGGCTCGATTCCAGTGGCATCGCAGAGAAGCAATGCCCGAGCGGAAGAGGAGAAGAAGGTTGGTGCATCTGAA
TCGCCGCCGCCGTCCCCCGCACGGAGCGATATTTCGTTTGATTTTGGTGGCTCGCCGCATGGCTCCGTGGATATGGATGCAAACATCACTGTGCGTGATC
GACGCGGCAAGAAGTCTACTGGAGCTGGTGGGGATAAGGCAAAAACGAAGGCTCGCCGGCGAGAATCTTCGGGCGCCGTTCGCGGCTTTGATGAGGATGC
AGCGAGTCCGTTTTCTATGAACGATGAGCCGGTGACTCCACTGTCAAACGGTGCGTGGTGCTTCCGGGTTAATGCATTTTATTTTCAGCGATGACTCATT
ATACTGCCTTGTTTTTTATCTTGCTGCAGCGAGCGACCGTACGTTGAAGTCAATTCCGTCATTTTCGGGAAAAGACTCGGTCTCGCCGACCATCACCAAG
GAGTTATTCAAGGAGGGGGGATACCGCAGCGATGCCAGTGAAAGAAAACCGAAGAAAAAACAGACGAAGAAGCCGAAAAAGGCTGCGGATAAGGGTGGTC
GCAAGACACCGCGACTGCGCCCGACGGGAAAATATGGCTACCGGAGTACTCCACCCGCAACCGATACCTCGATCCAGTCCGTGCAGACTGACGATGATAA
TGACGAGTCTTTCGAGGCGCAACACGACTCTGGTGGCGAGACAGGAGATGACAGCTTTTACAATGAGCCGGACGCGCCGAGTGGCAGGGTTCGAGACAGG
TTACCTGACGCCTCTAGGATCTTGGATGACGACGAAAATGATGAAGCTTGGGATGGCAGTGGCCTGCGTCGGTCGAAGCGGAAGCGTTACAAACCGCTTG
CATGGTTTAAGAGTGAGCACATGGTGTACGAACGCACCTTTGTCGGAGTGGGAACTGTGCTGCCTACGGTTGTCGGCATCGAACGTCTCGGTGCTGATTC
TCCAACATCAAAACGGACGAAGTCTAAGCCTCCGTCGAAAAGGACGAACAACAGCAAGCCCTTGAGACTGAAAGATCTGCCCAAGGACGTGCGAAAGCGC
ATCGTGGATAGCGAGTGGGCGACGCTTTACGACGGTCAGGCCGGTTGCATGAACGACCTGAACATCATCTGCCGCTCCAGTGAGATCCGTCTGCGTAAGC
TCCCCACGGAGGAGAGAGGCGGTGCAGTCGTGCACGCGTACGCGGGGCAGAGTTTCAACCTTTTTAGTCCGTCCCCTTTTGCGCGGTGGATCTCTGGACG
TGTAGTATTGCCTCCCGGCGCGTGGAAGGAACCAGAGGGTGTTGGTCAAGCCGTGCAGTTGTTCTACGTAACTGGATGCCAGCCAAAGTCGCTGGAGTTG
GCGGTGGCGCCCGAGACCGATGACGACTTTTTCACCAGCAAGCACACGACCCACTTTATGCTAAGCCCAGGCGACGAGTTCTACGTGCCGTCTGGTAATG
TGTACTACGTGAAAAACCACTCGGGCTCTGCGGACTGCGACTTGCGGTTCACGATTTTAAAGCCCGAGGCGCCGCAAATGCCATCCGACAACAATGACTC
CGATGCGGAGAAGGAGGAGACGAAGCCTGATCCGGAGTCAAAACCCGAAGCAGCAGAAGCACTCGACAACGAGCTGAAGCGCAAGCGAGAGGAGGACGTG
GACTCGGACTCGGTTTAGAGCGGTGTGCATTAGTGCTAGCAGCAGCAGTCTCCTTTATTCAGTACTTTGAAGTAGATTTGTTTCCTCTTGTTGTGGTGGA
CCGTCTCCGTCGTGACATTGCTGTCACACAGTAGGACGAGGAGCCGGAAAACTGTCTGACTCAGCCGGATAAAGCACCGGCTCCTGATTACGATCGATAC
GGGCATGGCATCTTCGTGGTGGTCTCCAATATGTAGCGGCGTCTCAATTTCAGAGACTCGCATGGCAAGGAAATAAAACTACCATCGCCATTGGGTTTTG
CGGCCAAGTGTCCACACGCTGTGACGGTAGCACGTTACAGCGTTTGAAGTTATGCGCGAAAACGACGTCGTGGGCCACAACTGGTAAAGCGTCGTCAACT
CGAGCGGCGATCTATGCGCGCACATGCGCATGGGCGCGGGTCTGCTATAAAAGCAGATGGAGTCTGCACGCACGAAGCCTCTATGGGTAGGTGAGCGAGC
ACAGCTGGAGGGCCTAAGAATACGCGTGGCGCGTGGTTCGGTGTCTTGGTGTCAGACCGAAAGAGAGGGGACGAGGTTGTCAGTGGCAAAGAGACTGAGT
GTCGGACAGCCAGAACACCAGCAGGTGCCGGCAGACTGCTGCCTGTCCTATACTGCCCCGCTAGCTTTCCGTGTTGCCAGCTCCCGATTGCTTATTTATC
GTTATTGCGCGTCGATCAGCTTGATTCGCGCTATGGATCCTGCAGCTTCATCGTCCAAGTGCGTTCTCAGCTTGCTGGGTACTGGTTGCCAACTAGATGT
GCTGCTCTTTACTGACGTATGGGCTGCGTCTGCGATAGGATGGACGACGTCTACGAAACCATTAAAGAAGGAAGCGTGGCTGTCCGAGGGCATTTCATGG
TACGAACGAGTCCAGTGTGGCATGAATTGATAGGAATATCGTGGTCTCACTTGTTGTTGGCCAACTTTGCAGTGGCGTGATCGCTACGTTGGTATCAAAC
CAGGCGAAATGATCATTCGTCGCCGTCGAGACGGCACCATTAAAGCCAAGGTTTGTGTCACAACTTCGTTTATCGAGACCAAGCTCGTTCTCATTTGTTG
TTGCTGCTGTCAGATCGACTTGCTAGACACCAATATCAAACTCACGTTCCTCGGCGGCCAGTCCTTGCTTACCATCGCTATGCACGGACGGGATACTGTT
TTGGACTTTCGCTCTTCAATTACGCGTGACGAGTGGATCAGTGCTATCGTAAGCGCACAGGAGCGCCCTGGCTCGGACGCTGACTGCGACGACGATGGAA
CTGAACTTCTTTCTGGCGAAGAAACAGACGAGGGACACAAGCGTAGCTCCATGACGAGCTTGGGGACCGAAAAGACCGACTCCATAGCGGAGGATAGCTA
CAATGATGCACTACTTGCATTGCAGAGCGTACGTGATTCCGTAATGCAGTGTCATCTCTCGATGAGCGCAGCCGAGGTCGACTCGTTCATTAATCCTTGC
GATAACCCCATCGCAGCAGCAACCTCAAAAACGATTCCTTCACTACGACGAGCCCAAAGCGCGACGCGCAGTGAAGAGGAACTTCGACAGAAACGCCTTC
GAGCACTGCTGACGATGATCGAAAGCACGCCTCACGGAGGACGTGTTGTGCTCTTGCACCTCGGAGTAATTGCGTCTGCAGGCATCACTGTTGGCGATAT
GCTGTTGGCACTTGGAGAAAAGCAGCGGGAAAACCCACGTCGTGGCTCCTTCACTCCGCGTACGCTGAGTGCCCAAAAGCACAGCATTGCGGCGTTTGTG
CGCGATATTTTGTTCCACCCCATTTACTCGAAGCGCGAGGAGGTCAACACCGAGATTGTTCAGGGGCTCATCGACTTGTTCTTCCCACATTGTCGGTTGA
GGCGGTTTAGTGATGACACGGAGTGGCATCAAGTCCAGCCGTCGGCTTCGGTAAACAACACATCCAGAGTTACAACAAAAAGTGAAAATGATGCTGACGT
TGGTACTGCAGTTCCGACAACCCCGACCGTAGCACCGCCAACTCCTGCATCGCGTCTTCAGAGGCGAAAGCGACGGAATCACTCGTTCCCGAATCTGGGT
GGTATATCTCAACTCACCAAGAGCAAGGGTTTGAAACAGACCTCGGTCGATGACAACGACCGATCTATTAGCACGCGCAAGTTGGAGGAAGGCAGCCAAC
GGCTACGTGACAATCTGTCCGTGCTGTTCGCACCATTCCCAGACAGCAAAGGCCCCAGCAGCGGACCAACTCCGTTTGTGAGTATAAGCACACCATTCGC
CTCCGACTCATCTGATGAACTCGATGTAGTATGCGAGGACATACCGCTCCCCCAGCCATTGCGGAAAGTCTTGTGGGAAATGTCGTGCTCAGAGTTAGCT
GAGCAGCTCACGCTTTTTCATCACTCCCAACTCTCGAACGTGTATCCGTGGGAGTTTTTGCACCACCCCAAAGAAGCTGCCATGGAGTTGACCGAGAACT
TCAACCGGTTGGTAGCATATTTCGTCTGGTCTGTACTGGTCGAAGACTCTCCAAAGGAGCGCGCAGAGGTCATTGAGAACATTATCTCCATTGCGATGGC
CGCAAGTGCATCCCCGCTTAATAACTTTCACCTGGTCATGGCTTGCGTGGGCTGCCTCGGAGATACACCGCTGATGTCTTCACGGATGCCGATCACGTGG
AAGAAAGTTCGGGCCAAGTACAAAACTCGTCTAGGTGAACTTCGACGGCTGTGCGACCATACCGGCGGCTTTGAGAACCTGCGACGCAAGCAGAGCACTG
AAAGTGCACGGCCCATGCTTGCCAGCGACGTATCGACTGTCTCAATTATTCCCTTCATCGGCGTTATCGGGGTCATGCTGGAGCGATTGCGATCAATCAA
CTACTTCACCTCGAAGAAGATGTTGGACTTGGAAAAACTTGAGCGGCAATACACGGTGCTCAATGTACTCGAGAACGCGTTGCTCAAGCCCGCTCCACGG
CCTTCTCGGGTGCCTCAACGCGGTAAGGTAGCCCCCATGGAATCGGCGACGGAAATGACAGCTCGCTTGCAACATTTTTTCCGGACACTCAAAATGGACT
TTGCCTCGCCTCGACTGCATCAGCTACGCTCGCAGCAAATTTTGGCAAGCGAAACGAGCTCCACGAGCTCAGCGTCGGCTTCTTTTGTATTATCAGCAAC
CGTCAACGGGAGTAACAGAGGCGGGGCCCCATTGACTGCAACGACCCTGGCAGTGAGCAAATATGACGCGCAAGGTTCTGTAGGTCCAAGTGAAGACTCT
GGTTTGGCATTCGTGTCCTTCCGAGACATTTGCGTGTTGTTAGTGTCTGTCCCGGAGATGCATGAGCGAATGCAGATGGCTCTCGAGGCGCTCTTCGTAG
ACGGTCGTCAGCCAGCAACGCAGTTCCTGCGCAAGTTTTGGCTCGATTTCAAGCAGAACGTCTGGGTGTCCGGCGTCGGCCCCACGCTCCAAAGCGTACG
CGTCTGCGTGGCCGCCCTGTACCAGGAAGTCATGGCGCACAAAATCACCGAGCTCATGCAGATCAGCGGACTAGACGAGAACTCGGCTGAGCTGCACGAC
GTGGTGTACGCAAAGGCCGTGGTGTTGACCGTGCAGCCTATTTATCTGAAAATCGTGTCCAAGGTCAAGCGCAACTTCGTCAAGGAGGACGCGCACGCAG
CAGCACGCCTGCTACAGAGTACGCCAAAGGTTGTCGTCGACACGAGCCTGCCGACCATGCCGTGGAGTAGTTGCAGCTGCACTTCTCCCGTCGAGTTGCT
GGACCTCGTGTGCCAGTTGACGACGCTGCCTCGTGCCAGCACCACCAGTGCAGCCACCGCTGCGACCGACCACCAGCTCGCGGCGGTGGAGCTGCTGGGC
GCTCTGCAGCATCAAGCGCGACACACCTTCCTCGCCACGAACCCGGTGAGCAGCTTGTACCTCATGAAGCAGATCCTGGACCCCAAGTACCTTCCTCTCG
CGCGACGACAAGCGCTCGAGGTCTTTGTCGCGGCGGTCACGTGGCTGCGCAAGGAGCAGAAGCTCTCCTCGGACGAGGCGCCGTGAATCTTCCAGCGATT
GCACGCGCATGTACCGGTACAGACAAGGCCTGAACGGATGACAGCCTGGTGACGCCCGACGCCGACCGAATGAGTGCACGCACACGTTGTTTTATGGCAG
CGCATGTTTCCTACAAGAGCCATCCATCCCCACTGAATTTCGGAGAGATGGCCAGAATATATTATCTCGCGCTTGCCATCGTCCTCGTATCGTATCGTCC
TCACCGTCTTGGCCCATTGCCCCGAGAGTCAGGGCAATGTGCAATAAGCAAGTGAAGGTGTCAACGCACTTCCAGCAAAAAAGTATCTTTTGTAGCACTG
CATAGCCGGGGCGGACGTCCTTTCGCCGGCCAATAGAAGCGCCGATCTTGATGCGCGCCGATTTTACCCACTCATCTCGCTCGATGTCGCGATATTCCCA
TTGGCTGAAAACCCGCACAGTGGGCGCACAGTAAGCGTCAAAAGTTACGGCTCCATGTAGCGTGGTGTCGTCGCTCGCGACTTTCCTGGCGGAACGAGCG
CGCACTCGTCCGCCAGCGCCCCATACAATTCCCTCCCTAGACCTTGGGCGCAAATACACCCCCCTCTGATACGCAGCCACTTCAGCACTGAAGACAGAAC
CCCCTCCCTCGATTTAATAACCCCTCGGGTATGCGCGTGTGGACTCTGGCGCTCGGTCTGCTGCACGCCGCGTCGGCCGCCAGCTCCTCCGGCTCCGGCG
CGAGCGGCACGCGCAACACGCTCACCACGAGCTGCAACGGCGGATGCAGCAACGCGTGCGTCGTGGTGGGGCAGTCGTCGGCCAACGCCATCGACTGCGT
GAACGACACGAGCTGCGTGACGCTGTCCTCGGGCCAGTCGGCGCTGTGTCTCGACGCCTTCGCCTCATCGGCCACCGAGTGGACGTTTCAACCGGCCGAG
AGCAACGACACAGCAGGGGCCGGTCCCTTTGAACGCGTGGGGCTGCTGCAGCTGGACGGCCAGGTGACAGACCTCACGTTCACCAAAGCAGAGCAGAATG
AGGAACCGCTCTCGGGAACGCTCGAGCTTTCGTCCATGAACATCCAATCGGATGCGACGCTGGACAAAGTGGCGTTCAGGAACTTGAGCTTGTCCGGTTT
GGACAGCGCCTTACCGCTCAACAGCGTCAGAAGAATGTGCGTCGCTGTGATGTTGCACGAGGAAGAAACTACCACGACTGACACTGGTATTTTATGTGGA
CAGATATTTCAACAACTGCTCCTTGAACGCCATCCCTACGGCTGCTGTGGCTGGAGACTCCGTCACTGTCATGTAAGAGCACATTCGATGCACTGCTTGC
AGAACTTGTTCTAATTTTCATTGTTTGTGGTGCAGTGATTTAGCAGGAAATGCCATCGCGGGGGTGGAGAGCGATTTCCAAGACGAGTCTTTCCCGAATC
TTACTGTACTGTACGTGCCAACTTCTGCTTTAACCTAGACTGCACCAACATTGCTAACTGAAACATGGTGTCTTTCGTGCAGTGATTTATCGGCGAACAC
TCTGACGGACTTCGACCTCGTGGTAGACAACTTTCCAGCGATCACGACCTTGTAAGTTCGCCTGCGGCGAAGTGTGCGCTGCTCGTAGCAAGCTTCCGAC
TCACCTTCCTGTATTCGTGTGCTTAGATTTCTCCACGACAACTCGCTGGCATCTGTTCCCGACGTGGTCTTCAATTTGTCCACACTCCAGCATCTGACGC
TGGCCGACAACCCTATCAACGCGTCGGGTCTTACAGTGGACCAGTTCGCATTCCTCGCGAATCTGAACGTGTTCACTATTGATGGCACCACAAACACGAG
CGCATGCCCAACCTCCGCTGTCCAGACCGCGCTTAACGAGTCTTTCACGTTTTGTGCGGGGAATGGAGACGACATAGAACCCTCAAACGCGACAGTCACG
GAGATGCCATCGACTACGGTGCCTTCAACAACTGAAGGTGCTTCATCTTCCTCTTCGTCGCACAAAACATGGATTATTATTGGGGCGTGTCTGGGTGGCG
TGGTGCTGCTGTTGCTGATCTTCTTCATATGGTGGTGCTGCCGTCGGCGGAGGAACGAGCAACCCAAGCTCATGAACAGTACAACTCCATCAATTGCAAT
CGGCATGGGCGACTTGTCTGACCACCCCTACATGGAGATGGGTGTTCCTCGATCCACCAACGCCTCTAGCCAGACGACGTCGGACTTTGAATTATTGGCG
TCTGTGGCAGACGGCTATATCGGACTTACTCGGCTATCGTATGACGACGTATTCCTGCACAAGATGCTGCGTGTGAGCAGCCGTTCGGAGCTATGGCTGG
GCGAGTACAAGCATGAGGTTGTGCTTGTCAAGAAAATCAAGAGCAACACGGCATCAAAGGCGTTGATGCGGGACTTCGTGACAGAGATCGAGCTGATGTT
CGAGCTGAAACACCCTCGCATTGCAGCCTTCCGGGGTGCTATGTGGGATGCGGACGGCACGGAGCTCTGCGCTGTGGTCGAGTATGTTGAAAAGGGAGCG
CTGCGTGATTGCACGGTTAACAATGCCATGGAGCTGTCGGTGCCAAAGCAGCATACCATTGCTCGCCAGATTTCAGAGGCCATGGCTTTCCTTCACAAGC
AGAACATTGTGCACGGCCGGCTGAATGCGTTCAACATCCTTTTGGACAAGGAATATTCCGCCAAGCTTAGTCTGTTCAGCATTTTCCACTACGTGAAGCT
TTCGCCTTTAGACAACGAGTGCAAGATCTTTGCCGCCCCAGAAGTTCTGCGCGGTGAACAACCAACTGAGAGATCTGATGTATACGCATTCGGCGTGGTG
CTCGTGGAAATCGACACAGGTGAGACCCCAGTGATGAATGCTCGGAGGCTATCGATGGAGCGATCGGGTCGCGAGGATGCTCTCTCTCCAACCGCCAAGA
AGACTGGATTCCGCTTGAGCCGCCTCTGCTCCGGCGTGATGAAGGAGATTATTGCAGCCTGTCTGGAAAAGGACCCTGCACGACGTCCATCAATGGCTGA
CGTGGCATTGGCTCTTAAGACTGGAGCGATGAAGCTGTGAGGACTCGCTCAGCAACGAAGGCAGGCTCGACACAAGCCACTCTGGATTTTATTTTCTACT
ACATGTACCGGTACTAGCCTGGACCACACGCCAATAGCGTAAAACGCTGCTGCATGAAGCAGAACTCGCGGTAGATGTAAGCCCGAACTCATGTAAATGG
GAGGCAGCCTCCCTTATTTTTACCCGTCAGGAAGCACAAGAAGAGCACTAGCCAGTTGTCGCTCTTTGTATAAAAACCACATAAAAACATTTAGGAAGCT
GGTGGTTTTTGCTGTCACGGGGACAAAGCGAACAAGGTGAGTGTACGACAGCATCAAATTGGGAGCAACCAATGTTATGACTCATCTGATTGTCCAAACA
TATTGAAAGAATTCTCATGCCTGTCAAGTTGACAATCAAGTCAACCAGTCGATTCAGCCCTGGAGTCAAAGCCAGCGATGAATGGCATCCTTCGCTGGCG
CCGCATCTGTTCCCGTGTTTCCAAGACACCGAAAAGCTTTCTCCCCGTCGTTTCGGGGGGTCGTGCTATTCATGTATGTACACGTCATTTCGATTTCCTC
GCTAATCACATGCAAACACGTTAGCAGACATTGCCGTGCCTCAAGCGATAATGCAACCAGTAGCACATTGCATGAAAAAATTGGATTGCCTTTTTCTACA
AGCTCGAAGTGCGCCAAAGCTATCATTGTGCCAATAAATATTCAACGCGCCTCCCTACTCCTACTCCTCCAATTCGCCCACACAAAACGCAATCCAATGT
GCGTGGAGCTGGTAGAAGTCTCCTATGATTTCCTATGTGCGCGCTCGGGTATGAGCGGCAATCACCATCATCGTTTCACAGATTTGGGCAAAGCGCCAGT
GCTGGTGGCTTGATGCAAAGAGCACACATTACCATTGCGCTCGTAAGCAGGCTTGCGGCAGCCTTCCACAACACATCGCTTGCCTGTAAGAAAACAAGTG
AGAAAGAGCAAAAATAAGCAGCAGCACGCAAAAGCAACACAGCGAAAAGAGAGCTCTGTGTGTGAGTATAACACGATCAAGAACAAATTGCTTGAGTCAA
AGTAGTCATGCAGCTCACCTCCTCCGTGAGCCCAGCAAAGACCGTGGGAGACTGCCGTCTTGGTACAGTTTTGTTCGCTGCATTTGCGACCTGAAAAGGA
AGCGGAATTCAAGTGAGTTTTGCATGACCTGTACGAATGAAAGGTAATCAATCAGCACTGCACCTCCGCCGTGAGACCAGCAGACGCCGCGAGACTTGGC
ACGGTTCTCGCACCCCGCCACGGTGCATTTCGTCGAGCCGCCTGCAATTGTTGCGCAAGGTTTGGTAAGCAAATCATGAAGCCACCTTTTTCAATAATCG
TGCTTGCCTTACCGTGCTTCCAACACACACCCAAATTTTTAGCACTGCTCGTGCACCCCACGACTGCACATCGCTTACCGCCCTGTTATCAAATCAAGCA
TTCGGTCAACATTGGATCCAATGCGAACAGCGAAACACCGCACAACTGCCACCCACCCCGTGACCGATGCAGAGTCCGCGGTTCACCACGTAGCGCGTGC
AGTTTTCAAACTTGCAGATCCGCGACTTCTTGATCGCAGCTTTGGCTGCTGCGGGCGCCGGCACATTGGCCTCTCGGTTCTCCGTCGCCGATTCGTCCCG
AGGGGCCCCTGAACTAACCGCGAGGTCCGCTGCAACGCACCAATGCAGCAAACACCGACAAGTCACGCTCTGCAAATCCAGTCGGTCGTCCGCAAGGTTG
CAAGGATCAGCGCAACGTACCGAAGCTCGACGTTTGGTCCTCGTCCGAGCCGCCGAGGATGAAGGCGAGCGAGCTCTTGCTGGCCGCGGCCGTCGCGTCC
GTGTTCATGATGGCCTCGAGGCGGTGGCGGTTGGCGGCGACCTGGAGCTGCTGCAGCGCCGGCAGCGAGGGCCCTTCTCGCACGCCGTGCCCATCCTGGC
GGGGCTCGTTGGTCGCCACTTGGTGGAGCCACGCTGCGCTCATGTCGACGTCGTCGCCGGCCGAGTTCTTCATGCAGGAGGCCGGATACAGCAGCATCCA
GAGGGGGCAAAGTCTTGAGATAGGGACCAAAGGGGTGTGGTGGTATTTTATTCTAGTGCTGCCTGCTGCTGGCAGAGTCAACTGTTCCAGCAGTCAGCCG
GTTGTTATCTGAATAATGGACTGCAAGAAGCAGTCGATTCAAGTCGACGCCTGCCCCGGCTGGCGAGAGAAAAGCCCCGAGCGCGGGCCGATGGTGCGTT
GATTGCTGTGGCCGCGTCACTGGAGACTCGAACCACTGGTGTCCGACAGGCTCCGCTATTGATGCCGGCTCCGGCTTGCGAGCACTTGCCCTTTGTATGT
CGCGCGGCGAGGCCAACGGATGGTGGCCAAAATTGGCCCCATTTCGACCAATCCAAAGTGGGTACACAGCGCCGCTTCGAGCTTCGAAATCCCGCCCCAT
ACTGGGGCCAAGCTGTTTTCTCCCAAGATCGCGCGGCTCGTCTCT