Description :
From Genome Similarity Track
Location :
Scaffold_357:12842- 14605
Sequence
1763 bases(100 bases per row)
AGATCCTTCCACGCGAATTTGTCAATCTGCTCAATTGGCGATATTAGTAACGGGCTTAGACCATGATTAGATCACCAAAGACCGAACACATCTCATCATC
CAGTGCGTGATCTCGAAGGAAAGCTGACTTCACTTTTACGATATAGTTCCGCGCTACCTTTTCATCTCGGACTTTGCCTGATAACTCTTCGAATCCAAGA
TCTCGAAGACTCTGATCCTCTGTGTGGTGGCACCGATATCCTTAGTCGTTGCAGTCGTAGCTACTTGAGGTCATCTTGTCTCGGGTATCTATAAAATATT
CGGGTCGTATTCTTCTGTTTAATGCACAAGCTCAGATTCTTCTGACTCTAAGTCCACGGATGGCTTGTCGCGACCTTCGATATGAGATTGGTAAGGTGTA
CTACCGTTCAAACGACGGTTCCCCTGGCGACTCATCTGTCGATCCGTCTGATGCTCTGCCGCAACGTTTTTCGGTGGAATTACAATATTTATCCATATCC
TTGAGCTCTCCACCACTCGATCTAATTCTTGCGACATCGAGAGATTTTCGCACCTCGAATTTTAGTCGTTCCTGTGACAGCTCAATCTTGAATACGTCGA
TCCGATTTTTTGTAACGATTTTCTGATGGTGCTACAGACAACCGGCGAATTTTGATTAAATTGTCTAAGTCGATCTCGGAGTCGGCCAAGACATAAGTTG
ACGATACCAATCGGTGTTCTCGGGGCGAGTCATACGGTGACGCAATACTGTCCTCTGGTGGCACAATCTTGCCCGCAAGAGGAATCGTGATCTTGGAAAA
CTCAACTACTGCATTCTTAAGCTAACCTATCTTGCATTCCATCACTCTCTCGCCCCGAACACGCCTGTGAAGAAACTGGTATCTTTCAAAATCTGAATGG
TCAGTGTGATCGCGACGATCTAACTGGAGACGGTCTCTGGAATTTTAATCGGTTGGCCAAACGATGCAATCAATTTCGGCTGAAGGGTCTGAGACACTAA
ATTTGTATAATCATCAGGGCCTCCAGTTTGGTGAAGTGGCATTACAACACCACACGATTCCACATTTCTTTCGTGGCATCGATCTTTGGTGCCACGGTCT
CTGACAGTCAGTGTCGGATCTCCAATATTGCGATCTCGGCATAATTTGATCATATTCTGCCTTGGCTGAAATCTCCAAATTGTGGCGATTGACGACCTTG
TTATCCTTGCTGTCCGATACTGGCTTCCGTCATATGTCTCGACGATCCAGCGGGTTAGTGGCGAAGAAGGCACAGGGGGTTCGGCAATCGCCGTTTACCT
TTCAATCGGCAGAACGTTCTGTGCAAAGCGATCTGCAGTGATCACCCAAAGAACCTCCGGAGGAGTTTATGGTCCCTCGTCCAGGTCGACCTCTCGATCC
TCTTATTGTATTTTATCGATAAATGCCCTCCCAAAACTTTACAGATCTAAGGATTTTGTAGTTCCGCGTGCCTGCGCCGATCTCTGTGTCGATGACACTT
CAAAAAACCAGGTTCTTTTTTTACCTTGACATCTTCGTCAGTGGACGCACGGTAAAATCTAAATGCCTCAGAAGATCCGTGCACGCTCATCGTTGTGGTG
AAGTCCATCTCAAACCAATGCTGATAAGCGGTCCGATCTTCCACTTGCTTGCCCAGACGTGCCGACCCACGGAGGAAGGAGGGGGGGGGGGACTATCCGT
GTCTTTCTGTATAATATTATGCTCGCCTTTTCTACCCGCCAGTTATGATGGGCTGGGCTCTTC