Description :
From Genome Similarity Track
Location :
Scaffold_26:128412- 130735
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009511Similar to Npal2: NIPA-like protein 2 (Mus musculus)

Sequence
2323 bases(100 bases per row)
GCCAAGCTGTACCTGTACGCGGGCGTGTTAAACTCGATGCTCGGCAGTTTCCTCTCGGCGAGCGGCTATTGCTGCCAAAAGTGGGCGCACAACCGCGTCA
AGAGTAATCCGACACTCGGCGTCGCGTCGCAACAGCGCACGTTCGTGCTCGGGCTGTTTCTGCTGGCAGTCGGCACGATCTCGGCGGTACTGAACCTGGG
CATCCTCGGCCAGGCCGTGCAGGCTCCGTTCGCGGCGCTGACGTTGATCTACAGCGCGCTCTTGGGCCACTTCGTGCTCCAAGAAGACTTCCTCATTTAC
GACTTCTTTTCCAGCGTGCTGATCGTGCTCGGCGTCGCCGTCGATGTGTTTGCCGCGCAGCTCTCGGAGGTGCCGCAGCAGTCGTACACGCTAAAGACAC
TGGGGAAATTGTTTTTCCGCGACTCGATCTTCCCTGTCGGATACATGGTGCTAGCGCTGACGTACACGATGGCGATTCTGCGTCAAGTGCACACGAACAA
CCTCCACCACCGCGCCATTGGGCTCCTGGCGTTCAGCTCCTGCGCGGGCATCATGGCAGGGTTCACAAGTCTCGCGACGAAATCCGCGGTCGAAGTCAGC
AAGTCGGCGCTGAGCCAGCACACGTGGGGGATCCTGCTCAACCCGTTCTTCGTGCTCATCATTGTCGGGATCCCAAGCGCACTGATTCCGCAGTTGTTCT
TCTTGAACAAGGGCCTCGAGTACTTTGGGACGCTCAAGTTCATCCCGCTGTACCAGGCGTTCATCATTCTTGGCAACATGATCTGTGGCATGGTGTTTTA
CAACGAAATGGCGAGCTACAGCATCCTGTCGGTCGTGTGCTTCCTCGCAGGCATCGCGATCACGCTCTCGGGCGTGTGTCTCTTGCTGGTCAAAGTGGAT
ACGACGCAGCACCACGTCGCGCAGATCCGCGATTTGCATGCGCGCACGGCTCCAAATGGCATTGAGAGCAACAAACTCGGCACGGAATTCACCTTTGAGC
AGATGGACTGGGCCGACCAGGACGTGACGACGATGCGCGATTTCGACGAGTGCAAGCAGAGCATTGTGAAACTGCTGAGCGCAGCGACCACGTCGGTCTA
TTATTCGACGTTCCTTTGTGACTTTACCCAGGTGCTCGCACGCTCGGACCTGGACGGCGAACCGATTACGTTCATCTCGCTGCTCCAAGCAGCCGTGAAG
CGTGGCGTCGAAGTCCACATCTTGTACAACCCTGTTGTGGACTACGGCACGGAATCCGTGGCCGAGTTGCAGCAGCAGCTCCCACCGGAGGTGCACTTGA
CGTGCTCCGTGAGCGACTTGGGCCCGAGCGTCTTCACCAAGTGCCTCTCCAACAACTCCAAGTATGCGTTCCACCACCAAAAGTACCTGTGCATTGACGA
GTCCGTGATCATGGTCACGGGCTGCGACGTCAACGCCGAGCGCGAAGGATGGCTCAAGACGAACCTGCTCGGGTACTTTTGGCACGAGCTCAGCGTCGTG
TGCCGCTGCACGCCCAAGATGTTTCAGTGGATCAAGGCGAACCACGCACCAGTGGCGAAGAAGCGTCATTATGACGAGTACCTGGATGCAGCGCCGTTCC
CACTGGTCTCAGGCGGCTGGCGCGAGGAAAACGCCATGGTCAACATGATTCTGCACGCAAAGCGGTCGATTCACCTGGAAAACCAGATCATGATCTCGGG
CGGCACGCTGCAGCACAACCGCATTTGTGATGCAATCATCGCGCGCATTTGCCAAGCGCACAAGTGGAACTTGCCGTTCCACGCGATCATCCTCACGAAC
GCGGCGCAGCAGGACGAGCCGTCGCAGGTCACGCGTCTGTACTGCTCGCTGTCGATTCAATGGTCACTGGAGCAGCTGGAAAACCGCGCGCTGGACAACG
GCCTGTCGCTCGACGTGCTGCGCAAGTATCTGATCGTCGGCCGCATGCAATACCACGACGTGCTTGTGAAGGTGCACTCGAATATTTTGATCGTCGATGG
CGCGTACGCGCTGCGGTCGTCATCGAACCTCGCGGATCGAAGCCTGAGTTCACGGCCGACGGACACGGAACTCGGCGTGCTCTTTGCCGGTGAGAGCGTG
CAACGGCTGCAGCAGGAGCTGTTCAACATGTACTTTGGGTCGTCGGGTGTGCACTACGCGATGGCAGACGTGTTTGAGCTCGTGGAGTCGGGCCACGGCG
GCTGCATCGTGCGGCTCGAGAAGAGAGCGTGGAGCCCGGTGCTCACGTGGTTTTTGATGAACGTGTTCATCTATGGGAGCGAAGGCGCGACGGGCGGGCG
CCACAAGGTCTCGTACGAGACGA