Description :
From Genome Similarity Track
Location :
Scaffold_29:1284009- 1288183
Sequence
4174 bases(100 bases per row)
TATCCATCTATAAATATACTCAGTTTTTTTACATTCTACCTTAAATTGATCACTTCGCTCCCTTTCGATAAAAGAAGACCTTTGAGCTGCCGTTCACTGA
GAGTTTGTATACTCTCGGAATCCAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGT
ATTCTACCTGAACCTCTCCGCCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCACAGCTCGAGTCGGTTCGGAAGATGACAGGCATATTC
GGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTTGACGCGTACGAGCAGGGGCTCATCGCGCATG
TGCGGGGGAACCTGCATGCTCCGGCGGCGGAAGCAAATCCGCCACACCCGAAGCTAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGGAGGCAAGAA
CCTTCACTTCGGGGTCCGAGAAGTAGATCTCGCGATGGACGCGGCTCTGTATCGACCGAGCAATTTCGTGCTGCTGTTGCACCCTCCAACCCTAGCGGTC
GTGCTAAGGGTTGGGTGTACACGCGGGAGGCAACATCTCCTGGGTGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGC
GAGCTACGAGTACTGCCAGCGCTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCATGAGCTGCACGAGTACGTCCAAGAGATGGGGGGGCCACGGCGTCCC
TAGTGGGAAACCCACTCAACGAACACATCAAGATGACCGTGTTTGTGGGCTGCCTTCGAGTGGGCCCAGCGCGCACTCAGCTGTTCCGGGTGCAGTCAAA
CACTCTTGAAGAGGCGATTCAAGTGAATCTTCAGGAAGAATACAGCCATCGCCAGGCGCGTACACCGGCCTCAGCTTGGCATGGGTGTTCTTTGTCGGCT
CCCGGTCGAGCGCGTCACAACGGGCCAGTTCTCATGAAACTCAGGTCCGCCGAGCAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCA
AGCGCCACTGTCCCGCAGAAAGACGCCATAGACGGTCTTTCCCCAAGCCCGTCCTAAAGGGTCGCTGGCTGAAGCCAGGATCCCGGGGACAGGGGAACGC
CGGAAACCAGTAGGGGCGGGGCGCTCTACTGAGGAAGAACATAGTCTTAGTGAAGGGTGCGTGAGTGGCGCGTACTACGGGGGATTAGCCTCTGAGAGTC
TTCGCACTCTCGATTCGGCGAAGAGCAGCGGCGGTACGACCATCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGG
TTGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGATGGTGTCAGTGCGACTGGCCGACGAAAAGGTCGTCTCTGTCCC
CAACGTCCAAGTGGATCTGGCCGTCAAGTTTAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGACATGGATCCATACGATATGATCCTGGGCATGC
CCTGGCTTGAGGAGCATGAGTCTTGGATCGACTGGCGAGGCAAGGCAATCGATGCTAGCCGCCCTGCGCAGTCCGACAGAGCATTGGCGAATCATATTCC
TACCTCTGTCAGGACCCGGGGCGTCCGCAAGGACTGCCAGGATACCGCAGTATCCGGCGGATGATTGGGAGTCGTCAACGTATATGACGACTCCGATGAA
GCTTCGATGGTGGCAGCGCTAGGAGGCGCTGACCAAAGTGGGTAACTAAGGTCCACAAGCCGGTAGCATCGTCCCTGCAGCTGTCACGGACGCTGGTAAT
AGCGTGCCAAATGTGGGTAACAGATCTCCACACGCGATCGCCCATAACATACCGGAAGAGGAAGACGTTGGATACGCTTCCTGTGTGGGTAACACAGTAC
CACACGAGGCCTCGAGTGCCTCGGATGTCGACGTCACGGCATCCCCAGACGTGGGTAACGAATATCCACGTCAAGGTCGCCGTCGACGACGATGACGACG
CGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGATTCTGGTGTCCACTTGGAGCCGTTGCCAGAGGTAAAAGCGA
TCGAGGAAATGGCGGCCGAGCCTTTCCTGGCCAGACTCAAAGCTGGGGAGATTGCCGAAATGGTGCTCATATGACCAGAGGCCACTTGGGAGGAGCCTTT
GTCCTGGACGAGGACGCCCTAGAAGAGTTGAGCAGACGCGCTTGGGTTCTAAGATCCTTAACAAGTTCCTGGATCCAGTGTATCCTTTGGTGATGGAGTA
TGCGGCCGTGGTGAACAAGCACCCACCGATCCAACTCCCACCAGATCGAGGCGTACGGCATGAGAGCGATCTCGTGCCTGACACAAAGTACAGTGTCACG
AAACAATGGCCTCTTCCACGCAAATAGTGCGAGGTCGTTGATGCCTTCTTCGCTGCGAAAGCGAAAGCAGGCATGGTTCGGGAGTCAAAGTTCCCGCACT
CGACGTCAACTTTCTGCGTTCGGAAGCCGAACGGGAAGTAGCGTCTAGCTCACGCTTATAACAAGCTGAACAGCGCGACGGTGCCGGCCCAAACACTAAT
CCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGAAGCGTACTGTACAATGCGCTGGATTTGGTAAACGGATACTATCAGATCCTGATGCGAGGGAGC
GACATCCCACTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGATCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAACCGCC
TGGTGACGCAATTGCTTAGGCACTGCGCGCCCTCGTACAGACGTACTTCGACGACACCTTCGTCCATAGCCGTGCCGAGGGAGGCGAGACGGTCATACGT
CGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGAGATCAAGGTTCTCGGTTGATTCGTAAGCA
ACGTGGGCGCTCGGGCTAACCCAGACAAGGTCAAGGCCATAACAGCATGGCCAACGCCCCAATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAA
CTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAG
GATGCCTTTGACAGCATCAAGGCCAGTCTCAAAGAGCCCCTGTCCTGGTCCTGCCGGACGAGACGAGGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTA
CGCCATCAGGTGTGCATTGCTGCAGGCCGACACGGCTCGACATGAACGAGTCATCTCGCTCCAGTCCAGGCAGTTCAGAGCCGCCGAACGGAGCTATTCT
GTCCACTACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGGGTTCACCTTCTGGTCTCCCGGTCCATCGTGATCTACACAGACCACGCAT
CCTTGAGGACGGCGACAAATTCGCCTCACCTCTTACAACGGCTGGCGAGGTGGCTGTCCTTCTTCGAGGAGTACAACCATCGCGTCGAGTACAAGCCGGG
CAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTATGGGTTGGACCACATCACACGGGCAGCAACGGATCTATATGATCGGATACGCATG
GCGTATCGGGACGATGAGGCTGCCGCGTCTATCGTCAAGTTCATCACGGCAGGAGCGAGCGCGAAGTCCGCCTGGCTTTCGTCGCGACAGCGCTCCCGGC
TCCACCAATATGAGTTGAAGGATGGCCTCCACTACTACCGGGTGGAGCCCAACGAACATCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTTGA
TATCCTCGCGGAGGCGCACGACGCGCCCTCCAGAGGCCACTTGGGCCGCGAGAAGACCTTCCTGTCGGTCTCTCAGGCCTTCTGGTGGACTCGCATGTAC
AAGTGGGTCGCCCGATACGTGAATACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTTC