Description :
From Genome Similarity Track
Location :
Scaffold_1378:1284- 5442
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1378-snap-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_1378-snap-gene-0.3DNA polymerase epsilon subunit
Pytar_ATCC12531snap_masked-par_contig_1378-abinit-gene-0.8DNA polymerase epsilon subunit

Sequence
4158 bases(100 bases per row)
CATGGTCGCGATGGAGTTCAACCACGACGAGCACGCCATGCGCCAGAAGGAGTTCTCGCGGTTGGAAACCATTTTCCGCCACGAGCTGGTCGAGCAGTTC
CGTCGGGAAAACAACACGGACGAAGGCGCGTACGTCGAGACGCTCAACCTGCGCAAGGCCGTCAAGCAGTTCTGGGTCAACAACTTTCTCAAGTTTGCCG
TCGTCGTGGGCCAGCCCGTGGAGGGGCTCGATGTCTCGGACGCCAAGAAGAAGAAGCTCGCGCTCCAGATGCTCCGTGACGGCCAGTACGACGCGCTGCT
CTCGTGGCACGCGTCGTCGTCATCCAACTCGTCGCCGAGCGTCGCAACGTCCGTGCCTCGTGTGCCTCGGGATGCCATGCACGCGAACGCTCATCATCAG
GTGGCCCACTGGTCGAGCGGGTACGCCAACCCGGCCGTGGATGTGGACTGCCAGCAAGGCCCCATCAAGAAGCAGCGCACGCCCGAGACCGTCGCGCGCC
TCCAGCAAATGGGCATCAACAACCCGCCCCATTTCGAGTTGCACCAGCACCAGCAGCACCCTGTCGCGACCTACGACTACAGTCGTGCCGGGTACGCGGC
GTCCCAGTACCAGCAGCATGATGGTGGCTACAGCTACACGTCTGCCATGAAGCAAATGCAGGACCGCGGGTCGCTCGACTCGTACGACAGCATGGTGCAC
TCGCCGCAGCACCAGCACCAGCAGGTGCAGCCGTACCCGGAGCCGGCGTCCGCCCACGAGATGATGGGGCGCCAGGCCGCGACCTCGACCGGTGCCATGT
CATACGCGGGCTACCGCACGACCATGACGAGTGCCGCACCGGCGACGTCGCTCACGGATGCGTCGTTCCAGAGCAACACGATGGCGTCGTCCTCGGAGGC
GACGTCGGCTGGCCCAGTGGAGGCCCCCACGGGTGCCAACCCGTGGGATGGACTCCTTGAGGAGATCTCGACCGAGCCAGCCCAGCACGTCGTGGATCCG
TCTCTCCAGGCGTGGTCCAACCTCAGCATGATGTGAAAAGAACCGTGAATCAGTCTCCGCTGCGATGCCAGCAGCCGAGCCGCATGATTCCTCCCCCAGG
AGAAGTACGCTGTCCAGGACAGCTCCCCCCGAGTCGCCAAAGGAAGCGCTTTTTTCCCCGTCTGTGTACAAGAGGACCCCAGCGATTGTCCCGACCATTT
TGCCGCGTCGATGTCGAGTGTAGTGTGTGTACATTGTGAGCATACCCGAGTTAGTATGAGGGCCGCTCGCCAGCCCCTCCCGAGAGACAGGAGGGGAGGC
GGCGCCAGTGGACTGGGCCGGGCGTAGATCGACCGTGCCGATCGATAATTATCTAGGCATATTTAATGACCCAGGCATCATTTTATTTCCACGCGTCCAT
GTTTCCACCATCTCTCCCCATTTTCTTCCATCATGGACGACTCGTCCATGGAGCTTCCATGGATGGCGCCCGTCGCCCCCAATCTCATTCGCGCCGACTC
TTTCCAACTACCTTCATGCAACATGAAGTGGTTGCATGTTGCTCGAAGGTGACCGGATTCGCCTGACACGCGAGCGGTGGGCAAGGGCTTGCTGGGAAGT
CGGAGCAAGATGGCGTTCGCGATGCGGATGCGCGCGGCGCTTGTGTGCCGCCCCGCGGCAGTCTCGCAGCGACGGTCCATGTCGCTGCTGCGCACGATCT
TTGGCATTGGCGAGTTTGAAGGCCAACGCAACCAATCGCTGCGCGGCACGACCAACAAGACGCATGCGTACAACCTCGCGCTGCTCGAGGTACTACACCT
TCGCTATTGATCGCTATGGAAGGTTATGGAGTGGCGCGACTGACGATGCACGTGCGATAGTATGTGGGNNNNNNNNNNACTATGGAGGTGTATGGAGTGG
CGCGACTGACGGGTGCACGTGCGATAGTATGTGGGGATGAGCGCCCACCCAAAATCACTCCTCGAGAAGGTGCGATGTGTCCGTTGCAGAAGAGATATAC
GGGCACATCTGATCGTGTGGTGATGGCAGGTACTGGAAGACGACCACGAGTTCCTCATGGGCCACGTGCTTGTCGGTGCAAGCCTGTGCATATCGCCCAT
GATCCATCAGGACTCGTTGGATGCGACCGAGACTCTCGAGGTCGCTCGTGCGCTGGCGCAAAAGGACTCGGCCACGCCCAACGAAAAGCTTCACGTTGCG
GCGCTGGACGCCATGGTCTACGGCCGGTACCGTGAAGCGGCAGCCATCTACGAGACCATCTTGCTCCACGATCCAACGGATTTGCTCGCCCAGCGAAGCG
CGTTTGACGTCTACGTCATGATCGGGTACGTCACTAAACTCCCTCCCTCACTATGCGATGGCTAATCTACAGTCCACCGTCCTAGTGACCACAAGAACGT
TCTCTCTACAATCACGAGGCGCCTTCCCTCTTGGTCGCCGAGTGATACTGGTGAGCAGAACCTAGCAAGTGGTACAGTGGCTGTGCGTGGCGTGGATTCT
AACGGGAACGCCTTTCTCGCTTGGGGCAGGCTTCAGTCTTTTGCTCGGCATGCAAGCGTACGGTCTGCTGGTGAATGGGCGACTGGATGCCTCTGAAATG
CTGGCCGAGAAGGCGCTCTCCATGAACGGCAACGACCGCTGGGCATGTACGTTCCAATCGGACCGATCGTATGCAATCTCTTGAGGGAGGTCTCACGAAC
CCGAATGACTTGGATCCAGTCCACACGGTGCTCCATGTCCTCGAAGCGCGTGGCAATGCCAACCACGGCGCCAGCTACGCGCTCCAGCACAAGGACGACT
TTGACAATGGCGGTCCGCTCGAGAGCCACCTCTACTTCCAGTGGGCACTGTACCTGCTCGACATGGGGCGCTACGATCGCATTGACAAGTTTCTCGAGAT
TTACATTCTTCCGCGCGCCCAGCAGCAGCGCCACGCCGTGCGCTCGCTCTGCGATGCGACGCAGTTGTTTTGGCGGCTCCACTTTATCGGCGAGGACGTG
ACGCACCTGCAGCAGCGTCTCTTTGACGAGTGGCAGGCCGTGTCCGTGGATGAGAAGGACGGCCGCGTCGCCCTCACGACCATGAGCAAGCTGCTTCGCT
ATGTAAGGACTCTGTTAGCAGTTTCTTTGGCTTTGCCAGACTGACACTGTTGTCCTTGGCAGAGTGTGCTCTCGTCGGTGGACGAAGATGCCGCGAACAA
CACTGGCGACAACATCCCGGACGGTATGGGAAAAGGACACCTTCTCGAAAGCCCCACAGTGGACAACGCACTCATGAGGCGGTGTCTTGTAGATCCACCG
GCCGATGTCTTCGAGTTTGAGAAGCACAAGGGGGTGGAGATCATGCCCTTCAGCTTTCCGCGACCAGCGGGTACGAGTCGGAGAGCCCGCTGGGATCCAC
TCGCAGCGAACTAACTGACTCTTCGGTATGCTAGGTGAACTGCAAGCCACCTATAGCGCCATTTGCCATGGCTTCATGGCGTATTCTCAGGTCAGTGATC
GTCTTGCCTGAGTGGCCGACTATGGATACTCAAGGCTGCGTGTTCTCTGTTAGGGTCGCTACCAAGACGCCGTGGACGTGCTACTGCCCGTGCGGGGCAA
CCTCGACGTGCTCGGCGGCACGAGCGTCAACCACGAGCTCATTGAGCTGCTTCTCGTCGAAAGGTGCGTGAGAAGATACGGCTCTATGCTAAAAAGATCC
ACAAGAGGCTGATATGTAGCTTGTGATGGTCACAGTGCCAGCCGGTGTAAGAACCTCCAGCTCGCCAAGCTACTACTCAACGAGCGCGTGAGCCTTCGCC
CGCAGAGTGCACAGGCCTGGAACACCTATTCGCGTGTGTCTGCCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGCAGTGCGCGA
TGCCCAGAACATGAGCTACGTGCTCGGTCTCGGGCAGGGCGGCAACAAAACCAATTAGATTTGGTGTCGCTTGGGTATTGGAATAGACAGAAAATGCAAC
CAGTTAGTGACATATGGTGAAATGTAATGCCACTAAAGTGAGATGAACACTTTCGCGGGAAAGCCAAAGAGCCAAACGACAAAAATGGCGGCAAAGCAAG
TGCTCCGCGCGTGCAAGCTCCAGGGGCTCTCGCTCCACCCGGACGCACTGCGCCGCCT