Description :
From Genome Similarity Track
Location :
Scaffold_59:128399- 131227
Sequence
2828 bases(100 bases per row)
TAGAACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCAGCAGCAACAAGCTGAAGCACCGCTTCATCAGACCATTTGCAGTCCTGGCCAGACATGAT
GCGTCGTACACCATTGACTTGCCTAAGTCAATGACGACGCACCTGGCGCTCTATGTTCGACGTCTTAAGCGGTACGTTGATCCGCAGGGGGTTGCTGACT
CGCAGATCCCCTTGCCCCAGCTCGTCGAAGCGAGGGCCGACCACAGACATCGAGAAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCTGAGAGGCAAAGC
TGCGTCAAGACCGTACACCAGCGGGGCCCCGTACGAACGGACCCCGGCGCCATACGCCGAGTACGTTGAGTTCGCCGGGTACGCACCATACGCGTACGTC
AAATGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGATAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGT
GCAGGCTCGCGACCTCTCGTTCCACCAGGTCCAGGCGGCCCGCAAGGCGAGCGAGCTCGCCCTGATTTCCGGCCTGGGCGGCAGCATTGCCGCCAGTCCC
AAGGCCAAGTGCAATCTCAAGCACGAGGACACCTTGACGGAGCCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGG
CTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCCTCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCTG
GAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGATCGGCTCCTGATTGACT
GCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCG
TACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGCCCCTTGGTAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCAC
GCTGCTCCAGGATGCGGGACAACAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTTAAGGACTCCACCCAAGCCCAGAACATGTCCTC
ACAAGAGCTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTACTCCCAAAGTGGATAGAGGCCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTG
AAGTCCTTAAACGGGATGCGGTGTGGCGCCAAGAAGCACACACCGAGCCGCCTCCAAGCTGTCAACAAACAGCTGTTTTTTTCTGAACAAGAGTACGCTT
GTACACACCCCTAGAGGTGTGACCACCCACAAGACCACGAGGAGCGACGAGAAGCTCCAGGAAGAAGTCAGCCCACAGCTCTCCTCGGGAGGCCAATACC
CTCTTGCGTTGATGACAGCTCCCTGACTGACGGGTGCCACCACCGAACCCCCACGCAGGAGAATTTCCACGTTGCCAAGCGTATGCTGCTGGTCGAGGTC
ATTCGAGACCTCCCGGGGCTCAACGATAGCGCCCTCCTCTTCCTCTTCTTCCTCCTACTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAG
CGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGGTTTAGAGGCCTTAGCACGCGCAAGAC
CCTCGGCAAGCGAGAGACGTTTGCGAGCATTCTCTTCCTTATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGACCGGACTCTCAGAGCGCATAGA
GATCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGTCCGCA
GGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCCACGAACCGAGTGTTCGGACGATTGTCTGAAGATGAGG
GCGACGGACTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGA
GCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCATGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATA
ACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGTTTCCGCCGCGCTCGCGCGGCCAAGTCGATGG
TTTTCGACTTTGATAATGAGAGTTTGTGACGAACACCTCTTCATTTTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGC
CCTAAGTGTATTCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGAATATTTGGTACAAGGTACCAAGGTCGTTCA
AAGCCAACCATTGGTTAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAAT
CTACCTTATTTAGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTA
GCGCAAGGTGCTGTGTGACCCCGTCACA