Description :
From Genome Similarity Track
Location :
Scaffold_425:12836- 17120
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_425-fgenesh-gene-0.5Beta-catenin
Pytir_DAOMBR486maker-pir_contig_425-snap-gene-0.9Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_425-fgenesh-gene-0.2UPF0171 family protein

Sequence
4284 bases(100 bases per row)
GTCCAGTTGCTGCAGATTCGCCACCAGTAACGCCAGCAGTTTGTGCTCCAACAGCGCGTGCACGAGTACCAGGCGCGCGTCCATGGACCCTTCTTCCGCC
TCGTCGTCGACATCTGTGAGATCCGCCAGCAGCGCGACCACATCCAGTCGGATGTCCAAATTCTCGTGTGCAAAGAGTCCCAGCAGCATCGGTACGGCCT
GCAACTCGACCAGCGTCGGGTAGAGAGACGCGGGGGCGGCGGCCACCTGCTTCCACTTGGTCAGCTCGGCGTCGAGCGCGATCTCCGAGTCCATGAACTT
CTCCGGTGCGTCCGGATACTTGGATCGCATCAGCGCGTTCTTGCGGATGAGCTTGTCCAGCGCGTTCGCCATCGACTTGAGCGCGCGCGCGTCCAGCTGG
TCCATCTCCTGCGCGCTGGCGTTCGACACAAGCGCGTCCAGCTCCTGCGTGGAGAGCGACGACGACGCGGCAGGTTTCTTGCGGTGCGTCTGCTGCTGGG
CGTGAGCGTTCGCGTCTTCTCCATGCGGGCGCTTGTTGCTGCTGCCGTCGTCCAGCACGCGCGCAAAGTGGTCCTCCATCCTGGTCGTCGTGGTGTCTTG
CTTGCTGCTTTTTGCCCCTGTGTGTGCTTTGGCAAATGCGGGCTGGAGGGCGAGGCATGCAAAATGGTGGAGCTAAAAATGAGCCTTTATATCATGTTGG
CTTATTTTATTTAGCTATTCAGAAATTCCTTTTAAAAAGGACTAGAAAAACTAAAAGATTTATCTGACCTTTCAAAATGAATTCAAAGCTGGCATTTACC
AATTAAATTTATAGATAAAGCTCTCATTCCAGCGACGAATGCTAAAACCTTTTTATTAAATGTATCTTTGCTAAATTGTCCTTCGTTTCGTTTTTGTGCC
ATTTTGGTCTGCTCCAACATGGGGGATTTCGCGAAGTGCTTGGTGCAGAGCATGCAACTCGTTGTCAAGACCCGAAAGGTCATGACGCACTATCGAGGAC
AAGAGCACATTTGACGCCGACGACGACGCTCGTAAGCCGCTGCTGCTGCTCGCCGCAGAGGTACACGACACAGAAAGTCTGCTCTTGGCCTCCGGTGGTA
ATGTCACCTCTGCGTCGTCGCTCACCTCGTCCCTCAAACCTCCACCGCAGTCGCTGTTCTCCTTGTCTTCGCTGCCGTTCTTCATAGCGCTCAACCGGCA
CTGTAATAAAAAATTCTCACGCTCGCGACGCCTTGAATCGTCTCGCTCACTGTGGCTCAGAGTACCCTTGTAATTTGCAAAGCTGGCCGAGCTGTTGCTG
CGTCTCGTGTTGTTCCCCTGAAGCGGTTGAACTACAGGTATCGGGACCTGAACGTTCGAGCGCGCCTTGAAGTGCGCAACCTGGGCCTCTAGTCGATCGC
AGTGCGCTCTCTCATCATGTAGCTGGTTCTTGACGCACTCAAGCTCGGCGCGCGCCTGCACGGCGATGATCTTGAACTGCGGGAGCTCACTGTTGACGAA
CGCGCGCAGCGTCTCGAGATCTTCGTTGCAGTCGCAGAGTTCGCCACGAAGTTGCGTGTTCTCGGCGCGTAGCTGCTCGACCTGGAGATCGAGCTTGAAG
AACTCGTGCGGTCTCTTTTCGTTACCAATGTGGTAAGAAGCATCGGGCTGTGTCCCTGACGTCTGAGCATTCGAAGTGGCTCTTGCATTCTGCCTCTGGA
TGAGCTCGACCTCTTCCTTCAGACTCCTCGCGAGCGCTCGCAGCGCCACGATCTCTTCTTCCTGGCGCTGGTGGTCTACGAGGACGCGCAGGAGCTGCTC
ACGCAGCCGGTTGCTCTCGTTTTCTGGTTCGATCTCTTCTTCAACACGAGTGGCTCCGTCGACACCGATGGTAGCTCTCTCAATGCTTGCAGCACCATGC
TCAGATGTACCAGTCACTAGCGCTGTCTTCTTCTTGCTTTTCTTCGCAGTTAGTGGTGGTGGTACTGCTTGAGTTGTCGGCAGTGGACGCGCGCGCGCTC
TTCTCGCAATCACCATCTCGTATCGCTGCTGGTGAGCGAAAAGATTTGCCAAACAGTAGTAAGTGAGACCAAGAGAGTGAGTTTATAGGGGTGACTCTTC
AGCGCCAATGGGCTTCAAACCTCGAGGCTGAGCCTGAAGATATATGCACGGCGTTTCAAGCCTTAAGTCGTCTTCTTTGGTCAGATGCTGAACAACGCTG
CGATTGAATATGGCAGACGAGCTGCGCCGCTTGGCTCGCCACGCGAAGAAGAACCTGGTGAGAGACTGGAACACTGGCGTCGCTCAGCAGCAGCAGAGCA
AGCAGCAGTCCGAGCTTCACCATCAATCTGATGACACCTGCGGCAGCGATGATGAAGATGACCTCGCCTTGGCAGCAGACCACCCGCTCGAGCCGAACGA
TCGACTGCTGCAATGGCTTCGGCAAGACTTGGAACCGTCTCCTGTGATCTCTTCTCAATGGGAAGCCCAGTTCAGAGACCACAGCCAGCCGAATGACGAG
GAAGACTTGGAAGCAGAGGCGATCCCACTGACCTCGGGCCAGGTCAAGCACGCGTACCGGACTCGCGCGCGCAGACAAGAGGTGCAGGACACCAAGCGAG
CGGTCGAGATGAAAGTCAAGAGAGAGGTATTGCTGGGTTTGCAGCATGACAGAGCGCAGGCGATAGCTGTGTCGAGGCCGAAAGCGAGCCAGAATAAGAA
TACTCAGGCCGAATCTCTAACCGCCAAGTCGACCAGGACAGCTAGAGTTCCACCACCGCCACAACCACAAGTCAAGACACATGACGAATCACTTGCTAAT
AATGCTGAGCAAGAGCAGACGCAGGACCCTCGAGTACTAGAATTGAGGAACCTCCCAGCGAGTCGCATGTGCATGGACTCGGAGTACCGCAACGAGACCC
TCGTACGGATCCGCAAGCAGCTCATCTCGGGTCACGACGTGCTCTTGGTCAGCGACTGCGCATCGACAGAAGGATCCACTTTGAGCGACATGAAGATCAT
GATGCAGCAACTCTGCGCGCAGAGCCTCATGTACTGCGTGCGCGAGCAGGAGGTTGTCCCGCGAGTCGATCTCTCGCCGCAGCGAGTGGAACTCCTGCTT
CGCACGCGAATTCCTCCGAGTTAGTGTAGTGGTATTTCAAACAAAGGTTCCGAGACAAGTAACTGCTTTTCGAGGGATGCTGGTGGCCTATATTACTATT
TTAAAGAGCGCGAAGGTATTTTAACCAAACCTTCAATTTCGTATATTAATATTCAAAATTTATTAATGTTTGTGTTTTTTCAAAGTTTATATTGTTTTTT
ACTGTTTTCACTTGTATTCTTTGGTAATTAATATGCTTAGCTTTGCCTTTATATTGACTCAATGGTGTTGTCAGTTTGGTCATTAATAAGTTCGCAAGTG
ACAAAATTGCGCTGTCACAGGAAAGCATACGCAACTCCATACTATTCATTTTCGTCACTGGACGGCATTTTGGCACAGATTTAAGCAGAGCACCTCGGTA
GTGATTTTATCGAAGTCAGTCTACCACGATGAAAGGGGAATGAACCTTTCTGACACACCAGAGAGGCCCTACACAAAGACCCACAGCGGCGAGACACACA
CAAGAAAGCAAAGCAGCAAAGCAGCATGAGTAGCCTGCTGGGCATCGCGCTGGTCGTGGACGACATCAACAAGGGCTGCAACCTGGCGTTCCGGTACCCG
GCGCCGCCGTCGGCCATGGACCACGTGTCGTCCTTCCACAAGCTCAGCCCCGCGCTCTTCGCCAAGCTCTTCCGCCCCAAGAACGCGCTCTGCAACCAGA
GCTTCGAGCTCGTGATCGACGACCTGCGCTTCGTGAGCCACCCGGTGCTCGTTACGCTACGCGCGCAGGTGCCGGCATCCGCTGCCGCCCACGGCATAGC
TGTTACCAATGCTGGTATCATCGGAAGTAGTAGCAGTAGTAGTACTGGTGCTACGACGAGCGTCACTGGTGCTGCGACTGGAGCCACTGTCCCCAACGGT
GGTAGCGTTACCGCATCAAACACTCCCGCAACGGGCGGATCAATCGCGACGATCAACGGCGGCACGACCTCTGGCAACCGGAACGAGACGACGATGTTCA
ACATTATCTTCGCGCTCGAAGAGGACCTCTCGCAGCTGGACGAAGAGGACGAGGAGGTCGTGCTGCGGCGCCGCAGGAGTATCACAGCATTCCGCACGGT
CGCGGCGCAGCTTGCAAACGGCCTGTTGCACGAAGAGCTACGCTCGGGGTTTGTCTCCAAGGAGGTGCGCGAGTTGCTGTACAT