Description :
From Genome Similarity Track
Location :
Scaffold_33:128357- 129425
Transcript NameFunction/comments
Physo_134638gag protein

Sequence
1068 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGTTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACTTGAATTCT
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGG
ACAGATGCCCTGCGTAGCTTAGCGGTGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCACCGAAGCCGGTGCAACTGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGCTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCT
AAGAGCTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATAGTCCCAGCTGTGCGAGCAGCTGGGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGGGAACCCCCTGCCTGAACACATCAAGCTGACCGTGTTCTTGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTTCGTGTGCAAGCAAACACA
ATGGAGGAGGCGATTCAAATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACTCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTG
CGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCCGAGCGACATTCGCTGCTACGGCTGTGGCAA
GCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTG