Description :
From Genome Similarity Track
Location :
Scaffold_222:12833- 15110
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_222-fgenesh-gene-0.8Cleavage induced predicted protein
Pytap_DAOMBR444maker-pag1_scaffold_222-snap-gene-0.15Conserved gene of unknown function

Sequence
2277 bases(100 bases per row)
AGCAGCTTCGCTCGTTGtGCCTGGAGCTGCAGCTGCAGCTGCAATTGTGCTTGTCtCGTTTTCGAATTGCTGGATGAAaCGCTGGCGGAATTCGTCTTGG
ACACTGCAGTGTAGTTtCGGTCCAGGAAGGTCTTCTGCTCATTTCGTTGCTGCAGAGCCTTCTCGTAGTACTGCTGCGTCGCGCTTTTCGCCACACGCCC
GCTGTTCGATTCTTCGTGAATCACTTGCGCTCGGATGAGTTCTTTGCGGCCATCCCGCAGTTTCGAGTCCTCGCTAATCCGGCTGATAAACTCCTGACCA
ATGTCGCCCCAGGCCTGGGGAACCCGAAACTCCGAGCCACACGTCTGGCAGCGTTTCTTCTTGTCGCGGTACTCAGAGTATGACTGTGCTACGTCGCACT
TGGGGCAAACTTTCTTGTTCAGATTGGCGAGGTACTCCTTCTCCCCCcGCGTGAGTTCCAGTTTCTGTTGTAGGCCCATTAGTTGCTGCGCATGGTATTT
AGGTGGTACtAaTGACTCACTTTTTGTCGGTTGCGCTCCGCAGCTTCCATTCGAGCGATAAAGTCGGCTGCACGATTGCCATCCCCAGCTTCGTCATCAT
CGTACGCATCTCTCCCACTCCCGCCTTGTTTCTTCTTCTTGACACGGAAACGACAGTGCTTTTCATCATCATCAAGTGCAAACTTGCGGTTTGGATCCAT
CTTCTTCGGAGCAGCCAGAGACTCCACTCGTTTCTGCAGGCACAGTTTGTTACTTCCAAAGCGTGTAGTGTGTCTTCAAACTAAACGTACGGCAATGGCG
TCGGGTGCAGAGACGACAACCTTTTGTTtAAGCTGCTCGAGAGTTTGAGGCTGCTgcTTGACTGTCTGGAGCAaCTTCTCCTGATACAGCGtcGGCTTCT
TGAtCCCAGCGAGCACGTTGTGCGTGTCTCCTACGAGTGCCTTCCTCGAGAGAGTTGTTATTCCATCAGGGCTTCTAGTCCTGGCCAAGTTTGAACTTGA
TGGCGATGAcGTGCGCGAACGGACAGACGAAGATGAGGAACAGCTCGACAGGCTCGGGCTATTGCTAGTCCGCGGCTTTgTCGCTcGCCCCGGGATTGTC
ACTTCGAGCTTCTCGAACTCAGACGCGCCGTGAGGATTTGACTGCGATGGAGGGGgATTCACTTGCAAAGCCGGTACTGGTAGCATGCCTTCCTCCTGTT
GAATCGTCTGGACTTTGGCAAACATCTCAGCGAGTTCGTTTgcGTCGTCTTCGTCATCCTCTCCGTCATCCTGGGCTTCTCTCATGGGCCTCGGCGTCTC
AGAGAAGTCGTCTTCGTCCGCATAGGCCTCTGCATAGGCCTCGTCATTGTTGCTCTCCTCGCTGCGtGCAGTTTCGCTCATATCGgAGTTTGAGCTGGTG
GgCTACCCAAAAaTACAGGCTGACGCTTGGCGAGTGCCGACAAAGCGGGCATTGGATGGAGAATGAGCAGAGCCGTGGATGTGACGACGCTAAAGCaGCC
TGTtGAGGCTGCGATGGAATCACTTCtGCGAGCCGcTGACACGCGAGTGAGATGGAAGCAGCCGGTGTCGGGAGAACCGAGTGAGCTCTACACATTCCTC
CCTGGGGTTTAtCGTTCCACGGAGGCTCGAGACGGCGACTCTCCGTCACCTGCTGACACGGAGAATGGTGGGGTAACACTTCTGCTTCACGGCGACAATT
CCTTCGAGTATACATGGGAAATGCATCGTCCATTGCCTCGAGCAGCCAaGTACACCGTGCAAATGGTCGGGAAGTGGACCAAACCCGTCCTGAATCGGAC
ACGTCGCGGCGAAGAGGATCAGCGAGTGTACCTCACAGTGGCCAAGATACGCTTTCAGCGTCTTTCGAACTATGGTGGGCGTGGCGCTGTGCGGGTTTTG
ATCCATTATGCTAAGCGTGTTCGTGTAGATACCGAGAACCAGTCGTGGAAACTCCAGCTGCGAACTCTCACGCGTCACGGTTCGGACTGGGCGCCTGTGG
GCCAGACAGAGCGCGGCGTGCCACCTATCAGCATCGTGTTCAGTTGTCTTGATGGtGGCTTCTTGGAGAGCGATgaTGATGTGCTGGCTGCTCAAGTGCT
CACCAATTCTCCCGCCTGCCGCGTGCTCGCTGGTCTCaCCAAAAAAGTGGCAAACAAACTCGGTGGGCCGCtcGACGTCATGACTGACAAGTGGCTACCg
CACAAGCACTTGCGTTTGGTAGAGTGCCCTCAAGAACGGGCTACGgTCAAGCGATTCAACCCGTTCTTCTGGTACGT