Description :
From Genome Similarity Track
Location :
Scaffold_1075:12832- 14398
Transcript NameFunction/comments
Phyta_totarag11951hypothetical protein

Sequence
1566 bases(100 bases per row)
GATGATTGCAAACGTCCAGCAACAGAAAGCCATGCGAGCTCTCGTGCAGCCcggctgcacgaagaagcggatGCGCATCAAGCCGGGCTTATTGACGCGC
GCTAGCGGATACAATCCGCCGGTTACATTAACACGAACTGTCCACGGCTGGGCCTGGGCGAGGAACAGGCGGAGAAGGGCTCTGCAAAAATAGAAAATGA
CAGCAAgcagacgaagctgcgcgagtcTCGGTCCGGGACCGAGACGATAAACAAGATGGCTGCCAGGCCGACATCAAGTCCGAGGTCGAGCGTCGAGACA
TTGGAAGCCTTGACGCATACCTGTACTGGGCTTCAGTACAGGGAGTATGAACTTGAGAACTCTCCGACGAGTGCGTCGGAGTTGACGTCGCATCCTATCA
TGAGCTGGAATCGATTCGCGCGCTTGACCTGCACGATGGACCATCGAGCAGATTTGCGTCCTTGCGGACAGTGAAAGGATGAAGTGCGTGGCGGAAGCGG
TGAAGCAACCCTTCACTGACAGTACCACTGAGAGTGAGGACACCctcagcgccaagacgaagaaacagCGCTTTGAAGAGCATAGTCAGGACTCTCTTAA
GTCGAGTCCCTTTTACGAAATTCTGCGAGAGTGCAAGGATGTGTTCCCGGACGACATTCCTGCGGAGCTCCCACAGAACAAGGGAATTCAGCACGCGATC
GACCTCGTGCTGGGCACGACGTACTGTGTCACGcagcagtggccactgccgcgagAACAAGTATTGACTATACTACTTTCCCTGTTAAGTAAGCGCCTAC
GGGGATTTTAATGCTTGCAAAGCTTTCCCCTACACAACAACACTATATCAACATTATGCTTTTCCGGCAAGCTCAGCGTACTTTATGGTACTTGGGTGGA
ACAAAACATATGGGATTAGTATATCGCTACAGCAAGATGATAAGTGGTGGAGTCGTGTTGGATGCATTTGCAGATGCTGACCATGCTGGGTGCCCAAAGA
CAAGTCGATCCGTAAGTGGGACTCACGGATCGTCTGAATGGGAATGTGTGGCATTGGCAGAGCAAAAAGCAGGGAACTATAGCAGACGACACGTGTGCAG
GGGAATTGATCGCCGCCCACAAGTGCACCAAAGAAATCAAATGTGCGCAGAAGCCATTGCGTGACATACGCATCTCGCAGCAGGCAACTGTAATACTGTT
CTGCGATAACCAGAGCAGTTGAAAGAAGTGGTTGTTTCCCACCTTAGTTGCGCTCGGTGTGCGACTTCGCACCGagctacttcgacgacgtgttcgtTCA
CAGCCGGTCTGTGGACGGGAAGACTGATGTTGAGATGCACAAGGTGCAtctccgtgagctgcttggGCTGATGCGCAAGCACAAGCTCTATGCGAACCTG
AAATGAAATCTATCTTCGGGGCGAGCGTGATACCCGTGCTTGGGTGCCTCGCCGGGAAGTACGGCGTACGTCCTGACCCAGAGAAGGTCAGAGTGATCAA
TGAATGACCGGAGCCATGCAACATCAAGGAACTGAGACAGTTCCTTGGACTTGCCACGTACCTGTG