Description :
From Genome Similarity Track
Location :
Scaffold_41:128303- 138419
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14719exportin-2-like protein
Phypa_INRA-310PPTG_14720myosin-like protein
Phypa_INRA-310PPTG_14721hypothetical protein
Phypa_INRA-310PPTG_14722dynein heavy chain

Sequence
10116 bases(100 bases per row)
AAGCAGACGCTCCAAACAGGCAGCAGCGTATGTGTGCACCACAAACTGCGAAGGATCCATGCAGTTCATCAGAAGAGGGAAGAGCTGATCCATCACTTCC
ACCGGCATCTGGCTACGGAACGTCGAGACAAACTTGATTGCGTCGGCCTTCAGAATAAGCGACGCCTGGTTAGGTGTCGACAGTTCTGGGAGCACTTCGG
CCATAAAGAAATCCATCAGCGGGACTCGGCTGTTCACTTCGGACACACCACGCAAACGTGACTGCTTGATCGCGGAAATAGCGATAACCAGGTTGATCGA
CACGTCCTTCATCGCCCAATTCCGAGCAGGATCTGCCTTGTACTGCTGCAAATGCGTCTGAATCGTGTTCATGCAGATCTGCGTCACAGCCTCGTCAAAG
TTGCCAAGCAAGCCGCGCACCAAGTCACGAGCAGCGCTGCGACGACTATCACCATCTGATCCTTCGATGTCGCGGCGAATGTAGTCCATCGGGTTGTCCT
CGAACAGTTCCTCATCCGACGTGCGCAGCTGCAGGTTGGTGACGACAATCCCGCACAGCTCTGTCAAAACCTGTGGAGACTCAAATAGTGTGCGGTGGAA
CGATCGCGAGGCCACCGACGTCAGGAACTTCATACACTTGGCTGCCAGCTCGTCGTGCTTGGGGAAGAGCGTAATACGGTTAGCTAGAAGGTTCCAGATC
ACTTCAGTGAACTTCTGTAAGAACGGCTTGAACTCCTCGTCGTACTTCTCCGCGTACAGATTAATATTCTCCACAATAGCCACTAGCAGTCGATCAATCG
GACCGGGTTCATCCTCGTTGTCCGCGTCTACAAGGGCCGGGTTCTCGTAGCTCAAATAGCTCAAGAACTCGCCCATCCACTCGGCGATGTGGTCCTCGAA
ATACTCCGGCAGATCCTGCCAGTTGAGCGAGTAGAAGATGCGGCTCATGTATCGCAATGCTGTCATCATCTGCGCCTGTTGCGCAGCAACAACGCCAGGA
GCACGCAGCGCCACGCCCGTCTCCTTAAAGAATACGAGCAATGGCTCCTGGAAGACCTCTAGACAGTGCTTGAGCTCGCGAAACAGGTCGTCGGACTTGA
AGACGTTACGGAACCGCTTGAAAATGGTGTTGGCTGTCATGAGCACGCCGTTGCGTACCTGCCAGTCCTGCTCGGTCTGTAATTTGTGTACCAGTTGAGC
CAGTAGGTCCATCCACTGGGCAGGGAAATCGTACTCTCCGATGGTCGTGAGCGCCTCAATGAGCTGCTTCTGTAAAGTCTCGGGCATGCGGCACATGAGC
TCCACCAGGTGCTGTTTGACCAGGTTCTTCTCGTTCTGAGGCACACATCCCTGCTTTTCCGGGTCCCAGTTGTGCTTGATGAAGTTCTTGAATAGCAGCG
CGGCTGCTAGACGCACCTCCTGCTTCTCGTTTGAACTCTCGAGAACTTGTAGAAGCAAAAGCACGTAGTTGGGCTGCGATGAGAGCGTGTTCAGGTACGC
CTCGGCGCCCTTACGAGTCTCTGCGAAGGGAGACAGCGTTCCCTCTAGAGACTGGCGCAGCATCGGCATGTTAGGCTCCGCCATATCTGCCGAGATCTTC
ACTCCGATCGGGTTGGTGGCTTCGCGTGGCGGCTGTGAATTGAAAAATGATGGTACCTTCTGGAACTGGATGATGTGCGCACACACACAAATACTTGAGT
AAATATGCTTAAACTTAATTATTTTTGTTAAAAACATGGTCAGCACGGATGCTGATTGGCCAATATTAGCTTAGTGCTTAATTCTCCTCGGTACGCATGC
TGATTGGCCAGGATGGCATTCAGACGAAAAAACCCATTAAATTTTTAATGTTTTTTTTCCGTCTGAATGCCATCCAACGGCCAGATCGTACTTTACTGTT
TCTTCTTATTTAACTTGTAAAAACGTCTTTTGGCTATTTTAAAATGAGCATTCAGCTGAATTGGGTTTTGTCTCCGATATACCCATTTTGCCAATTCTTC
ACTTGAAGCAAATTAGATTAGCATAACGATGGCTGAGGTGGACAGTCTGGTGTCGGACCTGCTGCAGGTGAGGAAGCTGTTCGCGAACAACCACCTTAGC
GACGTTCTGTTCATCTTCACGTCGGACTCTGGCGGTTCTCCTGCGTCTGACGGGGGCGAGAACGACAAAAGCTCGACAGCAGGAGACCACCTTATCCCAG
CACATCGGCTTGTGCTGTCGCTACGTAGCGGTGCATTCCAGACGGCATTGCTAAAAGCGAAAAGCAGCCAAGTGCCGGGTCAGGTGCGATTCCCACTGAA
GATTCACGTGCAGGATACGCCCTACCGCGTATTTTATTCGCTGCTGAGGTTCTTGTACACGAACGATCTTGGTGCAGAGGGGGAAGATGGAGGCAAGCGA
GGCCGAGAGGAATTCTGGCAACAGCTGCTGCGAGCAGCGTTCGTATATCTGGTTCCATCGTTGGTCGATATTTGTGTCAAGAGAATTACAAGCTTCTTAG
AACTGGAAAGTGATAAAGTGGAGGAGGAAAAGGTAGAGGAGGAGTGTGAAGATGCCGAGGAGCGGAAGCGACGGTTGCAAAAGAAGACGCTGGATGTGTT
GGTGTTTATGGACACAGTGTTGGCGACATACCCGTTGACTGCTAGACGAAGAGAACCGTCGGATTCGCATACGATAACCCCGCCACCGTCGCAAAATGGA
CGTCGGTCTACTGGTGACGGGAGTGATGCTGGCAGCTCAGTGCTGTCACGATGCGCCGAGGCTGTGTGTCAACTGCAGAGCATGTGCTTGAAGCAGCTTC
AGCACATGGATGAAGCTGCGTTCGAGGAATTATTGCAGAGTGACACTGGACGGCAATGTTCTACAGAGAGATTGTGCGAAATCTTGAGAATGCGATCAGA
TACGCCGCTGGTTGTGGCAATCCGATATCAGCTTGGTCGTGTGGTAAACGAGCTTCTGCTACTGGGAGAACCTTTGGATCAAGTCGGAGGCGATGAGATT
GATTTGCCGCTTGTTGCAGCACTGAAGACTGGGAACAACGCGATTATTCGCCGCCTGCTTGTCGACGAAAGCGCGCCGTTCTTCCTGCTCACCGACAAAG
TTCCGTTAATATTTTTGGCCAGCGCGAGTGGAAATGTGCAGCACTGCGATATCCTAATTGAACAGAACGCTGCTGATGTAAATCTGATCTCTCAGCTGAA
GGACGGTGACAAGGAGATTACTGCAGAATTTGGGCACCAACAGACCCCGCTACATATTGCCTGTCGAAAGGGCCACAGTGCGGTGGCGGAACTATTGCTA
CAACACAATGCCGCTTCTAATTTGCCTGACGAGGAAGGGAATACGGCTCTACACTACGCTTCAAACATCGAGACTGTTGAAGTGCTGCTGAATAGTGCAT
TCAGAACGAATGCCAACATTCCAAACAGGCGAGGACGGACACCATTGCACATTGCTGCAGCACGAGGAGACGTCGCTGTGGTTGCATATCTGATCCGTCA
TGGTGCAGAGCAAGACATTGTGGATGATCAAGGGCAAAACGCGTTTCATCATGCTGCTGCAAACGGCCACACAGCGGTCACTCTTGTTCTGCTCCACGAG
AACGAAGCTGCTATGGCAAATGCAAAAAAACTGGTAATAACTAGCGAGAGCAATGGAACGACAGAAAATACTCACTCTGAAGATTCACAGCAAATGAAGC
AAACCGGTGGTGGCGAAATTGACAGCGCAGAAGAGAACGGAGAAAAACGAGAAGAACCAAACGGATTTGATATTAACAGGGAAGACTTGAAGGGCAACAC
TGCTCTTCACCTCGCTGCCATGTCCCCATCCGAGCGGTGTCAGAAAATGCTGCAATTATTGCTGGAGAATGGCGCAGATCCGAACCGGGCGAACTGGTTT
GGATACACTGCGCTTCATTTGCTTTGTTCGCACCAAAACGGACCGGCGTCACTAATCAACGCATTTGTAAGTGGCCAAAGTTTCGCTAGCACCATATTGA
TATGTAACTCTAATTTGTGATTACTATATTATGTTTGTTTGCTATCCAGATTGAGCACGGTGCAAATATCCACGCGCAGAGCTTAGACGGTAGTACTGCA
TTGCATCTGGCTGTAGGTCGAGGAAGCGAAGACGTTGCAGTCGCACTGGTAAGTGCCGGTGCCTTCGTGCACCTGTTGGACGCAGCAGGACGCAGCGTGG
TGGACTTGGTGGAGAACACGAACCAGGGATCGATGCTAGTGCCAGTGCTACGCAACCTGTCGCACCCACCCGAGTGGGTGGGTGACGAGCAGACCACCGA
GTGTTCATCGTGCCATACAACCTTCCGACTAGCCATGCGCAAACACCATTGCCGCCACTGCGGTCGCACCGTGTGCTACAACTGCTCCAGCAACAAGATC
ACCATCCCAAAGTTCCAAGTACTTAAACCCGACCGAGTTTGCGATACCTGCTTCGACGTATTGTCCTTCCGGAAGCTATTGTAAAAATTCGCAAATCAAA
CATCTTCAAGATATTCCCAGATGGCTACATTTTTTCTTCCGTTGACAGATGTCCGTTTTCTTATTGGCTAATATTCTCGATAATTTGCCATGGGTGGTCA
TTTCAAGAATAGGTCCAGCAGCTCCAAGACTTTCCCACCGGCCGTGTGTGCACGCCGCTCTATTGCCGTCTCGAGCTGCCACTGCTCCCTACTGTTGCTA
TGGCCTCACCGGGTGAGGCTCCACCACCTGCACCCGCGTCGATTGCAGCTGGAAATCCTTCACAGGCGCGGAGCAATGGCGACGAGTTTTTTGTCACTGC
GAACCTCGTGGGTGCCGCACTACGCTGCGTCGTGAATCCACAATGGCCGTGCGAGGCACTCCTAGGTGCGGCAGCTGAAGCCTATCACGCCAATTTTCCG
AACAGCGAAGTTCCCGAGTGTAACGTGGTGTTTCACCGTAAAAAGCAGGAGTTTTTGGTGGCTGGAACGCCAATTAACGAGTGCTGTGCAAGGGGAGATG
AATTGGAGCTGGGTGTGACCGTCCCGGCCCACGGTGCTACTCACGTTGATGCTACGCCATCCGTTGCTGTCAGTAGTGTCAGTGGTGTGGACAGTGATGG
AGAGACCAGTGAGTTCTGTGTGTTGTTTCACAAGCTTCCATTGGGGTTTACGATGAAACGTGGACATGACAGCAGTACGGAGGTGGGAACCATTTATCCC
AAGAGTGCAGCGACCCATTTCCCTCGGCTGACACCTGGTGTCACCATCGTGAGCATTGCGGGGACGCCACTAGAGGACATGGGTCTTCGTCAGGTGCACG
ATTTGATCAAGAACGCTGGTCTCCCATTGGAGATTCATTTTCGTGGACCTGAACTAATGGTGCCTCCATCGTCGCCTAATCCCGCACAGCAGCAGCAAGA
ACGGTTGTCGGCCTCGGCTGTAATACCCCCTCCTCATCCTCAGCAACAGGGAAGACGTCGCAGAGGGTCTTTTGATCGCCGTAGTGTGCGGAGCAACGGT
AGCAATGGAAGTGGTCGCAGTCGTAACAGTCGTGGCAGTCGTGGAAGGAAGAAAGGTGATTCTACTGAACACAAGGGTGCTGACAACCAGCAGAAGGGGG
AAGGTGGTAAAACACGTATACAAGCAGCAGGGCACCGCGATGCAAGCGATTCAAACCAGCGCAGCGGACCAGAGGAGCATGATGCGGATCACAACACCGA
AGCTGATCTGGTCGAGCAAATCGAACAGCTTAAGGTGGCTTTACTACGCAAGCACGAAGAAGCCAAGCAAATCGCGCGTCTGCTCGAGACGTGCTCCGAG
AAACTACTAGCTCTACGTGGCGAATCTGGTGGCATGGCAACATCTCATCAACAGCAACAAAGGCAACAGCCCAAGCAAAATGGCACCCCTCGTTCACGTC
GTAGTGGAGCACCTCCATCGAATAATGGTGGTTCCAAGGTTCGACTGACGCCTGAGGTTCTAGAGGCCATGGATCAGAAAGCTGGCCTTCCTCGACGTGG
CACAGGCGCGTATGCTTCATCGAACGTGTCATCAGTCTCGGGGTATTCAGCTCAATCCATGCCAGTAGCTCGCTCTGGGAGTATGCGAGCGCGCAATGCT
CGTGCCGCGGCTCTCGCCAATGCCGACAACGTGTCAGTATCGTCCTATACATCGAACTCATCGAACACATCTGCACGCCGCGGTGGCAACCACTTGAATA
AACGGTACAACTACATACCGCAGAAGTATGCAACAAGCACAACGGGAACTTCAGAGGCTGGGTCGACTTCTCTGTCATCTCGTGGAGCTGTGATGTCGCG
TGCGCGGATCTCGCGTGACTCGTTCATTACCAAGAGTGAGAGTCCAGGTGTCGGCTACTACGACGTGCAGGTCAAGGATCGCGTCAAAGGTGGTGAGATC
GGCGACTCGGACCGCTCGTTACCGTGGTCTTGAGTGTTGGATACCTCAACTGGAGATTACGTAGCACTGGCATTTGTCTCTCCTTATAAAGTACGCATCG
ATAGAGCATTGAAAGTGTTCCCGCGTTAGCTTGGCAGTCAAGTTGTTGGCTGCATCAATTCAACTCAACTCAATAGACATAGTCTCACATAAGTATTGTT
TGATGGCATCCTTGGATCTTTATTGAATCAATGCTTGTAAAAGTACTGAATGACGCATGGAGAGAACTCACACGTACGCTAGCGCCTACGCTAGCCACTC
CTGGCCATGGTTATCGGGTTTGGATCGAAGCTAACCCAATCACATAGCTGGGAGTAGCCAGCCAGCGACATAAATACTTGACTACGTCCTAACAACTATA
GTATTTGCTCCTCTTTCGATCTCGAGAAAATGGAGCGACAACCACGTAGACCTCAGAACTCGGTCACGCCGGAAGGAGAGTCGTCCCGTTCGTAGATATT
TTTGTTTCGAGGACCGAAGGTCGCTTCGAAGTGTTCCCAGAGAGCTTGAAAGCACGGTGCGACCTGTTTCTCGTCGTAACCCGTGAGCACCGACAGCTCG
TCTCTCCATAGTGGGGTCACCCCAAGCGCCTTCCGAGATGCCACCAGTACACTCGCAGCTAGAACGGACGGTCGATATACCTGCAGCGAGTACTCCTGCA
ATACCAGATCCACGAAAAACTCGGCGTATTTGCAGTAGTATCCGTGTGCTTCATCCACCAGCTCCGATCCCAGCAGTTGGTCATCGGCAAACAAGACGGT
CTGACCCATATAATGTTGCAAGAAGTGCAGCGGGGTCACCATGGTGAGATTCCAGCCCAATCTGTACACGAGCAAAGCAAAATTTAGCACCGTAACAGGC
AAAATAAAAATACTCGTGTGCCTTGGCAAAACTCCCAGCCGTTGCATGACGAACAAATTTCCTCACGCACTTTTGGAAAATATCTGCCTCGGCATCGCTG
ATCTCCTCATGCGAGTACATTCGGTTCCCCATCTCCCAGAACTCGGCCATGGGAGGCAGTTCCTCATCCGTGCCTAGAAACTTGAGCGCCACGCGTAGGC
AGCTGAGTGCCAGCAACTGAAATCGGTCTTTGCGTGGCAATGGCGCGTCGCGTGCTAACACTTTCTCGAGATATCCCACAGCGGCGTGTACGTATTCTTT
GCGCATACGCAGATGCGTCTCCCCTACTTCGGCCATCCAGTCGACAAGCACGCGACGGTATTTGAGGTACTCGTACTGCTTAGAGAAGTCCGGTCGTAGG
AGTTCCTGGCGCAGCATGGCGCGGTACACAGCGTCCACGTCACGGTCTTCCAGTGCCACCATCTACAAAATTGCCAATTATTGCCATAAGAAAATTGTAA
ATATCGAATGGGCATAAAGTGTCTAAATGAGAGGGGGGAGGCGCACAGTTTGCTCCTCGAACGATAGCTCGACTGTCCAGGGCGCGTCGGACACGAGGAG
TCCGAGCATCTCGCTCGTCTCGGATTCCTGCGTACTCATGAAATCGTCGTCGTCCAGCACTTCGTCGCACTCGAGGCATTGCGCTTCCCACTCCATGATG
ACGGCAACTACTTTTTCACGGAGGCGAGCAAGGGGGGAAGTGAGGGTTGGGCGTTGATAATTTGCCACCGAGCAGAGCTGATCGCCGTGTCTTGTCGCCT
CCGCCACAAAGCGCAAATGTGTTAGACGATGGCAATGCAATGCACCCAGCGCCTACACCTGGCAAATTGTGACCCGACCATACAAAACTCAAGTCAAAAT
TTCCATTTGAAGCGCAAGTCGCCCCGTTTCTGACGGGATATCTCCTGCCCATCTCTATCAAGCTACTCCACTAAGTTCGAACGCTCTGTGCTGCTTGAAG
GTCTTGCGAACTTACAGCAGATGATGGCTACCTTCATGCTTTCCATGCCAGTAGCGCAAGTACGAGCGAAGATCTCGCGCTTTACGCGTTGTCGAGGTGG
CGCGGAAAGCGGAGACCATGTTGTCGCACAATCACACGATGCGGTCGCTGATAAGGTTCCCTAGCCCGGATATGCCGAATCCATGCCAGAAACACCGCGA
CTGGTTTAATTTTTTTGTCGCTTCGATCGCTTGGCCCAACGGCACTTTATCCGAATACTTCTGTGTGAAGGAGAAAGAGAAGAATAGAGACTTTCTGTTT
GCATCGCTGGCGAGAAATTCTGTCAGCAAGTTTGCAATGTATTTAGAGTAGTCCGTGTAATGATGTATACGTGCACTAAGATCTTCATAGCCCTCTCCTA
TTATCTAGTCATCCAATTGGGACAGCATGGCCACGCCACGTGCGACCCAATGTGCCTCCGGTCTGCTTGTTGGCAAGCGGATGAAGCAGATGAAGTTCGT
CGAGTGGCCCGTAGTTGATAGTGTACCTCGTCGCTCGCTGAAAAAAGAAATCCACTTTAGATATCTTCAATTGAAAAAAAGGCAAGACAAGCTACCCGAT
CGCACCTTGTTTTGTAGACTGGACACGAGTACGAGCTGCGTTTACTCATTTCGGTCTTCTTTACCGGTTGGAATAATAGCACCGGTGCCAGAGAAAACAG
TACCTTTGGATCTGATTCCCCCAATTCGTGCGTTGATTTATCCCATTTCGCACCTTCAAGGAACAACCCGCGCACATACACGCCGTCCTGACCAAAAACA
CAAATTCGTGAGTTTCCCATTGCCACCACGGGTTATCATTTGCAATCGTACCTTTGGTGGTTGCGCGTAGTCATTCCTTGGCATCGGTTCGTGGTCGAAC
CCCAATTGATCAATTGGCAGAGTATATTTCCGGGCATAGTTCTGGCTGGCACCAGTCAAGAACGCTTGTGTGAAAAAGAAACCCGAGATCCAAAACACGA
CCGGAGGCTTTTCCAACAGCCACTTGTTGAAGAACGCAATGCGCTCCAACAAGTCCGTCACGTAGCTACCAAGTGGCTTCAGCGAAGGATACGACTTGGA
CGCCCACAGCGCTGGAATTTTGCCATAAAACAAGCTCTTGGACACATTTTCAAGCTCAGCCGACATGACCACGAGGCCCTTCAGCGCCTTTTGCAAACTC
TCAAGACTCGACCGGATAGTTGACATTAGGTTGTTGAAGCGTACCAGTTCTTGGCAGAGCACCGTGTTCATGGACTCGTCCCATCGCACTGGGTATCGAA
TTTGCGCAACTTCCATATCAAAGTTCGGCGGTAAACGTGATAAAATATCATTTGCCACAACTTCGACGAGTTCTTCTTGGGATGATCCGCTACTACCTTC
ACTCCCACCACCCGAACTTTGAGTAAGTAGCACATCGCGACAAAGCTTGGCTGTTGCATTTTGGTCTTTAGTGATCGTAGCGTTATCGTGCAGTCCAAAT
ACTCCAGGAGGAGCCACTAAAGGCAAACCTTCAATGAATTTTAGGTACGATTCGTACTCGCCATCAGGTGGTATCGTGTATAATCCTTGCTCATCGAACG
CATAGTCCTCTTTGAACACGTCCAAGCAGTAGAATTTACCCAGAACAGACATGAGTGTACGTCGATCCTTGTCATCCGTCACACGTCCACCGTAATTACA
CTCTCCGGTGCAATAATTCAAAGCGCGCAGTGGTAATTGAACGTTCTCATCAATAAACATGGCCAATTGACGAATACTGATACTCAGGTCGGACTCGTTG
AATTCATACTGAATGT