Description :
From Genome Similarity Track
Location :
contig_43:128291- 129444
Transcript NameFunction/comments
g6338.t1hypothetical protein

Sequence
1153 bases(100 bases per row)
TTAAGCAGCGAGCGCAAAGCCGATGCGCGGCTTGCGGGTGTCTGTGCCCCAGTCAAACACCGTGTAGTGTTTGCGCATGAACACGTCGCCCAGGATCCAC
AGCGGGCCAGCGGGAGCTGGGATGTCAATGCCCATGAAGGCGAACAGACACAACGGCCCGCTCTTCAACGTGTACTCGTCCTTGGTCAACGTGTACGTCT
TGCCATTGAGCACGAAGGAAATATCGGGCGCAGCGGCCGTGCAGCTGATCAGGTACTCGCCCATAATGAACTTGTACGCTCCCACCAGCTTCGCGAGCTT
GGCCACCTGGTCCTTGGGTCCTGCAATGAGGGACGTACCCGAGTCCACAATGGCCTTGTGCACGTCTGTGAGTTTTTCTCCTTTCGTCTGCACAGCGTCC
AGTGCCACCGACCAGTAGGTGGCACTCGTCACGTCCACATACTCCAGCTCGCCCTTATAATGAGCTTTATCCACCCCTCCGAACGTGAGCTCGCCGTCCT
TCTGGTCTCCCAGATAAAAGGCAAACACAGGATCATCCAGTAATCCTTGCTGGATCATCCGGTGGAAGGGCGTCTTGAGGTGGTCCACACTAATCGTGTC
AAATGCCAGCCCGAACAGGCCGTCGAATTTGCCCAAATAGTAGGCAGGGCCCAGGCCTTTGGTCACGTTCACCTCGGCGAAGAACTGGTCGGCCACTGTC
AAGCCGCCCAGCTGCAGCTCGTCCTGGGACAGGAAACCCGACACGGGCCCGCTGCCGTACTGGATTTTGAACTCGGTACCGTTGGCCTTGTACGTATGCG
ACGCGTCGTGGTCGTACACTTTGTGCGCGCCGAACTTCTTGTTGGGCACCCAGAGGTTGCTCGAGCCCGTGTCGAAAATGACCGAGAAGGGTGGGGCGGC
GACCCGATCGAGATGGCGCCGTAGTATTGCGCGTTCTGGAAGTCGCGGATGACGACGTTCGCCGAATCTTCGACATTTTCGACGTCGGGGTTGAAGGTGT
CGGAATTGGGCTCTTGGGGGCTCCAGACGGCGGGGCGCTGCAGCGCGTGCACGTCGCGTAGCAGCGAGGACACAAACTCGTCGTCGCTGCGCTTGATCAT
GGGCACGCGCAGGACGGCGGCGTCCGAGGCGAGGAGCAGTGCCGAGACGAGCA