Description :
From Genome Similarity Track
Location :
Scaffold_631:12829- 16466
Transcript NameFunction/comments
Phyag_g7151hypothetical protein PHYSODRAFT_566381
Phyag_g7152hypothetical protein PHYSODRAFT_533462
Phyag_g7153hypothetical protein PHYSODRAFT_289190

Sequence
3637 bases(100 bases per row)
CCACCCTCGTACAGCCCAGTAGAAGAGCAGAGAAACAGGTTTACAGGTCATGGCCAAGCGCATCCGAATGGCCAAGCAAGAAGCCGCCGTGCCAGCGCCC
ACAGGGCTCCCAGACGCAGCCAACACAGCTCCGAAGGCGAAGGTGGCCACACCTGCCAACGCTGAAGGGAAGCACGTGATGCTGCCCGCGTTCCTGTCCA
AGACGTACGAGATCTTCAGCATGCCCGAGTTCGCGCACGTCTGCGGCTGGAACGCCAACGGAGACACCATCATCGTGTCGCAGCTCGAGGCCTTCgtggc
catggtgctgcCGCGCTTCTTCAAGCACCGCAACTTCCCGTCCTTCGTGCGGCAGCTCAACCTCTACGGCTTCCAcaagacggtgctggacTCGAAGCGg
ctcgagttccagcaccCGTACTTTAAGCGCGGAAGGCCGGAcctgctacaccacatcaagcgcaaggtgtccaacagcaaccaccacaaccaaCAGCTCG
TGAGCACGTCACTTCAGGTGGGGTTGGGAATGCAGGAAAACTGGGTTGAAGAATTGTAGGCTGATTTTGTGTTTTTGTTTACGTAGAATTCGAGGCTTGA
TGCGCATCGGGAGATCTCGGACACGCTGCTTCgtgagatgaaggagctgcgtcaACGTAGCGACGCGATGGAGAAACGGCTGCGTGAAGTGGAGATTGAC
AACGCTGTACGGGCGACGTGGGGATTTTTTGGGGTGTTTACACAAGGGTTCTGATGgtttttttgttttgtttttgcGATGACAGATTGTTCGTAGTGAC
AATCTGAAGCTGTGGAAGCATTTGGAGGCTGCGAAGGACAAGCAGTTGATcatgcaggagaagatgaagaagatcatgtgGATTTTGTTCCAGATCTACC
GCggaaagcagcagaaccttCCCAAACTCTCCAGCAACGATGGCACTAGCGCAGTCATCAGCGAAGAGTAAGTGTTGTAGCCATGCGATGCTGACTCATA
TTTTTGCAAAGCTGAGTATTCGATGTGTGACTAACCGatttttgctgctttgtgGTATTTGCGATTCGTGTCTGCTTCCTGTTGGCTTCGATTTTTTTCT
TTGACCTATTGGTAGCTACATCGACAACAGTATGCTTGGGCCAAAGGAGTTCCGTGACGTATTGCGGTTCTTAGCAATGGACGACCCCCCGCTATTACCC
GGATCATCCGccaatgttgctgctgcagcaccaggcTCGCGAAAACGGAAGTTTGTTGAAGTCCCTTCAGATGTTGGTGACGATCTTACTGCTGGAGGTA
CTCCTTACAAGCTAGATTCGCTTCTGCTTTTTTCGCTTTGCAGTTCGGATGACCCCACTAACTTATTTTGCTGTTAGATGTAGAGCCATCTTCGGTTGTT
GAAGTGCCTCACACCCTGGAGGAGACGAACCCATATGCGATGACAGTACCGTCCAACACGCTTCCCGTGGTTCACCCAGATGGCGGGCAGAACAACGTCC
TGAGCATCTTTTCGCCGATCAAAGCGGGACACAACAGCATACCCAATATCGATCAGTTGAGCGGATTCCTTACGAATGGTGTGGACACGGCACCGACTGT
ATCTTCACCGACTGTATCAACAGCAACCGTACCGACACCGATTGTTTCATCCCCGACAGTGACGTCGCCAATTGTATCGACGGTATCGACGCCAAATGTA
TGCACACCGGTCGCCAACAACGGAAATCAGACACCGagtgaaaatgctgcagcttcaaatgGTGCTACAAGTGAATCATCAACGGACACACACAATCAAC
TGGCATTTctggacgaagagctgccTCTACTACCAGACTCCGACCACTACAACTTCAATGACGGCGAGCAGGTACTATAATGCGTCCAGCGGTCTTGCTT
CTCTGATTTTTGTTTGCTCGTGGACAGTGTTGTAATGGCGTGCCTTTTTGTTTGGCTGTGTATTAGCAGGCAGTAATGAAGAAACTCGAAGATTTTGAGA
cgtcgttgctggacgagtacgacgtCAGCTGCCTCGACacgctgcttcagcaactAAAAAACTCCAACGGGGACAAACCAGCGGCTGTTTCAGTGCCAGA
TCCGGAAGAGGTCGTGGTGGGGTCAGGCAATGCTTCGCCGCACGATGCATAATGCAGACTTAGTGGGCTGAACCAGCATCTATCTCGACTGTTAGAAGCC
GGTGATGCCTGAGAAGACAACCCCACTGAAGAAGCTACATATCCATGTACATGTCAAGCAAGTTACTGCGCGCGCGTGTTATCACTGGTGAAAGgtctgc
agcgctgctgtAGTATGCCTGTTGCTCCTCTCGCCGGCTGATAGACAAGCGTCGGTGACTTGCGTCTCCTCTTCCGGATAGAAACAGATCGAGTGCCCAA
AAgtcaagaagcagatcaTGCGCAGCGATGGGAGCAGAACATAGCAGCATCCCGATCGATCGCGACGCGAAACCAAGAGGGACGGAGACGAGTTCGTACG
AACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGATACGATGACGACCCATACACAAGGCTGTTTTTATTTATGCAG
TGATGCGAGAATCGAGACaaccacaagaagaagaaaaaaacaaGAAACAAAAATTGGTTTTCTACTAAGATGCACAGCACCGTTCATCGTTTAGATGTCT
CCAATAGACTACGCAGTCGTTGgatctccttgtccttgcgGCCAAGCTCCAGTTGGGCCGTGGCAAAAAGAGTGGAGATGTTGCTCTCCAGTTGCTTGTT
GGCTGCACCTAACTGTCGGTTCTGCTCCTGCAACTGCGCCAGTTCATCTCGAAGTCgcttgttctccttctccacttgAGTCTTAAGATCCAGCgcctct
ttcttctccaaggcgctcgtggacgtgtcCAAGTCGCCGTACAGGTCTTCCTCTGTGCTCATCGTTGTCAACTTTCAAGAGTGATCCCATACAAACTCCC
AGCCATCAGTCCGGTTCGGAATTAACGATGGACTCGAGATGCACCAAGTTCTGGGAGGATGGCCAAGCGCTGGTGGCTGCTGTGTCTGGACCGGATAGCG
CTGCTAGGATGGAGACAACGAAAAGAAAGATATTCAAGGAGTTACGCACCATGAGTCGCTTCCTGCAGCGTAACCAAGGCCAGCGGTTCAGTGACGCAGC
GCAAcagaagctcgtggactGTGTGGGGCACTATGTGGGGCTGGGAAAACAGGGAGGCGTCATGCTTCCAGTGGCTGAGGCCACGTTCCAGACAGTCAAA
GACGGACTCGCGATGCCGTTCAATGTCATCGGCACTAAACAGAAGAAGCGGCTGCTGAAATGGTACAATGAGCTCATTGCGATTGTCGGAGGAGACCCGg
acgctgcaattgctggagaagttgttgCTGAGCCGAGTATTGAGTGGAGTGTCATGGACATCGACGAAGACGGATTCCTGTCGCTCATGCAGGTGGAAAC
AGGTGAGACCAATGAGAGTTTtcaagtgaagaagaagagcgcagAATACAAACGCATCAAGAAGGCTCTCGAGAACCACGAAGTCACAGTTGTGACCACT
GGCGACAACATCGAGGAGATCCGAGTCGAGGACGAGT