Description :
From Genome Similarity Track
Location :
scaffold_12:128287- 130470
Transcript NameFunction/comments
g773.t1 conserved hypothetical protein
g774.t1hypothetical protein

Sequence
2183 bases(100 bases per row)
AGATTGGTGAGGCGAGCAATGGAAAAAGAGAACAAGAAGCTGCGAGATACTGCCAAGAAGGCGTTTACTACGGAGGTGCGCGAACTCGTGGAGTTTGTGT
ATCGCCGCGACCCGCGTGTACGAGCCTTCCAGAAGCAAAAGGAGCAGGAGAAGGAGCAGCGGCGTCTTGAGGAAGAGGCTAAGAAACGCGAAAAGCAAGC
CGCGTTTGACGCTGAAAGACGTGCCTTTCAAGAGCAGCAGGAAAAGCTGTGGGCTGACAGCAATTTGGAGACCAGTCGTGTTGCTGATAGAGATATTGAG
CAAGAACTTGAGAAGCTCCGAAAGAAAATGGATGCGGGCGTGCTTGTGTGCGACTTGTGCAGCAAGACATTCAAGTCCACGAAGCAGTTGCAGAACCACC
TCACTTCGAAAAAGCACCGCGAGAAGGAGGAGGAGCTCGGTGTATTTAGCGACCTCAGCATGTTGGATGACGAGATGGATAGAGCTCTCCAGGAAGAGCT
TATCGCACTTGGCAAGGTTAAGGTTGAGGCTACTGAGGAAGCACCTGCCAAGACAGCAGACGAAGAGGATGTTGATACTGAGCAACAAGAAGTTGATGAG
GAGGCTGTACTTCAAAAAGCCAAAGCTGATCGTGTGCGGCTTGAAAAGGAACAGAAGGCTGCTGAAAAGCGCCGGGAGCGCAAGGAGATGCGCAAAAACA
AGAAAAAGGAGAACGTAGAGAAGATCGTCAGTGGTGCGCGCTCTAAGAAAGAGAAGAAGGAAGAAGAAGAAGAAGAAGAGCAACGTGGTCGTGGCAAGAA
AGGAAAGAAGCGGAGATAGATGACGCTGTCAGGATTCCTATAGACGCAATTGAGGTTTGCTGAAGCAGTATTGAATTACATGGTTATGCGGACTGACTTC
TTAGCGTTGTTGCACAGTTCTCGCATACAGGCATCCATTTAGACGCTGCACACTTGGTTACTGCTGGTGCTGTTCTGCACTCCGAACACTGTATGACGGC
TTCTTCCGGTCTGTCAGCGGCAGATTTTGAGGCTGAACCCTGATCCTCCGTTGAAGGCTTGTCGTGCATTCGCATTTGACTGAGTTCGCGCTCTTCTTTC
CATCGCGAGACCCGAGCACGTTGTTGCTCCCGTCTCTCCTGGTCAAGCTTCTTCTTCAGTGCAAGATCCCGCTGGACACGTTCTTGAAGTGTGTCGAAGT
CGTTGTGGACTTGATCAAAAAGCCACTGAAGGCCTGCTTCAAGACGATCATCTACAACACCGCCGTAAACTGCTGGCTTGGCAACACAGGGGGCGATTTT
GGAGCTTGGAAACTTGTTTAAACGCAGCAATTTCTGCATTTCGTGCTCTTGTATCGCGTCGGAATGGTCTCGTTTGTTGGCGAAGCTGCCAGTTCACACA
AGTTCGTCAGCGTGATTTCAAGTACCAAATTTCATTTTGTACGCACATTAGCAGCGGCTTGTTGGTCATCAGTTCGTTTGCCATCGATTCCTCGAGTACA
TTCGCAGCCTGAAGCACCGCATTCTCGCTTGAGGAATCAACCACGAAGATAATACCATGGGCCTGTACACGATCAAAACGTTCAGCTAAGTACGATGCAG
TTGTGCAGCTTATTAGGCTATTGAAGTACTTACGTCGGCGTAGTATTCCTTCCATACGTTGCGGAATGTTGGGCCTCCTCCAAGGTCGTAAAAAGTAGCG
GACCCTGTTTCGGTCTCGAACGTGGCAGATGTGAAGCCTGCACTCGGAACGTGTTCTTTGTCTAGATCGCCTTGTAACGTGGATAGAAGTGTGGTCTTCC
CTGCTCCGTCAATTCCAATAATCAGCAGCACAATCGCCATTTTGCGGGTGATATTGGCTTTTTCCTGGTTATCTTCAGGTTCTCCATTTTGTGTGGTTGC
TTTATCGCTGGTTTCTTGTGTAGAGTGTAGCTTTAGACACATGACATGGACATTGCTCTCTGTCTTCCCATCATCGTACAAGACGCTAAAACTACCGTTG
TCATCGACAGCGGTGATGACGCCTGGAAAGAACCTAGGCCGGCCTTTATAACGACAAAGAACGCGGTCTTGGACGCTGAAGTGAACTTCAGCTTCGCGTT
GGTTTGATGCTTTGTCAGAGTCGATAATGATTCGTGCTGCAACCACATCTCTGATAAAAGCTTTGGAACAAAACACGGATTAG