Description :
From Genome Similarity Track
Location :
contig_84:128279- 130797
Sequence
2518 bases(100 bases per row)
TATCACTGGGTTTGGAGAAGGCGTGATAGGCCTTCCTCTACTACACACTCATCTGCAGTTAAAAAAGATCCCCAACTTGGCTCCGTCACTGTCGACCAAT
TCGCTGCTGTCCCCGCGTTATCATGTGCAACCGAAAAGCTGCAAGGCCAGACGTGTCACGATGGAATTGTGGTAACGCCACTCAAACGCCATCACGGAGC
TCCAAAACAAACTCTGTACGTGGCTCTTTCACGAGCGGTGAGCTTGAATGGCCTCACTCTCACCGAAAAAATCACATGAGAATATCTAGACAGCTTCAAG
CCGAATGATGCGACCGTGCTCGAAATACAGCGCCTCATCCAGCTTGTCATTTTGCCGCCATATGCATCTGCAGCAAACCACAGTGAATTTAGTCAGTGGT
AAGGAAAACAACATGCGTAGATGCAACATTAAAAAAATCCAGTTTTTTGTCTTCTTTCTTCCTGTTATGGGTGACCATACCATAGCATCATACGTTCCCA
TCAGCGCTCATTACAGCCGTGGGCAACATGACAGCAAACCGTGACAACATGTCTCCACGTAGTCCCTGACAGCACACACGCAAGAGGTGAGTATAATCCT
AGGTCACCAAGAGGCTAGACTTTGACGTTCTACCTTCCCGCTGCGACTCCTTGAGTGAGCGATCTTTGACTGTGTCTAATCGCTGAAAAAACATACCGTA
TGCTATTTGGCTGTTCGTAGCTGAAAGACCTCGTGTAGTAAGGTGGCCTTCTATTTGATGTTTATGTGTTTTTCCCTATAGAAGCCTTATAATATGCAAG
ACGTGACTTGATGTCTGTCGTCTGTCGAGGAGGGGTTTGTCATTTTTGATCTTGAGTCGTGAATCGGCTGAGGTAGGCGTGTAGCAGGTCTTGTGCGACT
TGAGAGTTGTGTAGAGTGAAATGTCGTGTCTGTTTGGTATTTGCGAGTATGCGTACGGCTTCCAGACTTGCTTTCGCTGGAGTGCTCCATTGGACTGTGA
AGAACTGATGGAGTGTCTGATCCAGTACTTGGACTTCATTGCTGTCGTTGACTTCGTTGCTTTCGCTTGTTGTTTCCGATACATTGTTGATAGCTTTTTG
CGCTGTTTTGTCCACGCTCGCAAGTCGTAGGTATGTCTCTGCTGCTCTGCCGTGGTGTTCCACTGCTTGTAGTCCATGTGCCAATACGTGTACTGCATTC
GCCTGCCGTGACCCCCTTGTCGAAAAGCTGACACTTGCTGCTTCAACGCCATGCCACTGCTCGTCCTGTTCTTCTGCTAATAGTATCCATCCTCCGTGTA
CTTGTTCTTCTGGTGTCGTGCTAAAGTGGTACTGTAGCGTCCATTTGACTAACTTGGGTATTGTTTCGTTCGTGTTGATTGTCATCATGATGCTATGACA
GATGCTCAAGCAGATTCCTTGGATTCTTGTTCGTGGATTCCGTTTCCAGGCACTTGCCACTGCTAGGACTTGAAATTTTCCTGCTGCGTAGACTGCTGCT
TGTGTGTCTTGTGTTGACATTTCCTCACCTTCAAATATGATCTTGTTTCGTAGTCGCCAAAGCAAAACTGGGGTCACTGTGGTCCAGATTCTCCATAATG
TTGTCATTGCCGTGGTGTGGTGTGGTGTCCATCTAGTGATGCATTTCTGCGCCATCGCTAGAAACTCCATTGTAAGTGGAGGTGCTGTTCTTGATGCTGC
TGCTGGTTCTAGGTCTTGCCGTCTTCGTTCGCTGACTGATTGGCCCATCCATTGGTTGATCCATTTTGCCCATGCTGATTGCGCTGTTGGGCAGTCCCAG
AGTATGTGGTCGATCGTCTCAGTTGTACAGGTGCATTCGTTTTGTGGGCAGCTTTGGTTGTCAGGCCACTTTCTGTGCCATAGATTTAGTGCTCCGATTG
CTGCTCGATATATTGTCCAATTTTGGTAGTCAGTAAACACTCCATGTTGGTCCCATCAATTGTCAGGACTTTGCGTCAGTGCTGCGTTCCCCCAAATCGA
TGTTGTTGCTCATTTCGTGATTTGTTTTCGAAAATTTGTTGTAGATCTATATTCTGGGTTTGTCGAAAGTATCTTGATCGTTGTCGTCGAAGTTGTGCTG
TGATGTTCTTGGCCATTGTCGCTGTGTTTGCCGTCCATGGATATAAGGCTGTTTGCGGGTTGGGGGTGAATACTATGCCAACAACACGTATCCAAGCTTG
TAGTTCTTGGTAGTCCTCGCTGTTCTTGTAATTTGGCGCCGACCATGCAATTCTCCAAGTCCACCCGTCGCTGCATAGCTCTAGTCGTAGTACTGGTGAG
TGAGTGTTCATCATTGTCGTTGCAATGATGCTGCCCTCACGAGTTGGATCATTGGACCACTTAAGTTGCATCTGGATCTTGGGGAGAGTTATAGGTGTAG
CTGCGTGCTCAGGTTGTTCCCACAAGTTCCATGGTACGCTGTGGAGCACGTTGTTACACCATTGTCTGACTTGTTCTTCTTGCCGTCCCCTAGCTAGTGA
TTTCCTTGTGTTCGGTTT