Description :
From Genome Similarity Track
Location :
Scaffold_84:128273- 133886
Sequence
5613 bases(100 bases per row)
CTTTCAGAATGGATTTGCCGTACTATTATACCGTATCGGAAGAGCCTAAAAGGTCCAGTCTCAATTGAAAACAAGGAAAAACGGACTGGACTGTCGGAAT
CAGCACATAATTAGCATTATACTGTATCACCATATTTTAGCTGTCAATGAAAGTTTTACCAAGACTTGGCCATTTCTGTGAAAGAGAAAACCTGGAGATG
ACAATAAGCGTAGCTTGTCCTAGGTCACTTCTATGTTGAGTAAAAAGAATTGTGAATTGTGACCGTTTCTAATCAACAATCTTTAATGAATGCTTCGTCA
CGGTCACCACGGACTACCGCATTACCTAATGTTTATAAGCGAAGTTTTGCTCTGACCGGTAGTAAGCTGCCATTTTACTGAGCACAAGCCTAACGTATAA
TACGGAATAATACTGCGTCTACTATTAATATAGAGCGCGGTCTATAGGAATTACCGCGTTGTATTCGATAGCGTTGTATATCTTTGGTAAGCGCTGACAG
CTCAGGTGGCTAAGACAGACAGCCCCATTGGGGAGCAGGGCTGTCGCGGGCTCAAACCTATCGTACCCGTTAATTCTCCGCGCTAAAGCTTTAACTCTCT
TCGCTCTCTTTCTTTAATCTCTTGTCGTAGATTAGCTCCATGAGCTCGTTCTCGATAGTCCCCAGCAGTGACTTGCGAAAACCATCGATGATACAACTGC
GAGATGAAGCTTCGTCGCAAATTTGCTCTCGGTCCCGCCACCATTGCCGAAAGCATGATGCGCTTATACGCCAACCCAACTGACGAAAGTGCTTCCGGCA
CGTGATGGAAAACCACCACCTTCAGTCTCTACTCAGTCGATCGCACGCTGTTTTAAACTGATCTCGAATATCTTGCGCTGTGGTGGCATGACGACAAAAT
TGAGAATGATCGTAGTTAAATGGTAGCGAGATATTAGCTGAGCTGATTTAAGAAATTCTAGACTTCTAGGGTACTATTTAATACGATTGGCTTAGAAAAA
ATAAGCAAAAGGGCTCTGTAGAAATTTAGAATTATAAATTGTCTAAGGCAGCGCGTTGTATTCAATGGCGTTAAATTTCTATAAAACGCTCCAGGCAGGG
CGCTCAATTAGGACGGCGTTTATTCGCTAGAGGAGCACTAATGTACATATATTCCCTATTAAATGTTATTATCAATTTGTGGTCGGTTCTATTGGTTATT
GTTATGCTCTATTCCTACCCTTTTGAATACTGGACTTAAGGGGCTGTTTCATTTGAGAATAAGTAGCGGAACTAGAGAATTGGGCTGAGCACCTATTGAA
ATATACAATATCTATTTAAATCTATAATGACTTTAGATTAGGGGTTAAATTGATACCGGAATCTACGGGTTTTCTGCAACCGTTGTATTAAGTACCTTCA
AGTAAAAACCGTAAAAACGGCGGAAGGCATAAAATCTCTCACAAAATACTCCTGTCCATTTGAACCGTCGCTTTGTCCACAATATTGTAAGAGAAGCGCT
TTAGCTGGGACACTGTTTTGATGCCAAACTGGCTAAATTTGTTGGTGCTGCAGTCTTCTTACGGACTAGTGGTTGCAAAACATTGATCGGTATGTGCTTT
AAAATCAACTCGAGGTAATCACGTCAATGTGTGGCTTCTATATTAACCCCTCCGTTCCCAGATTTCAGGACCTCAAACACACTAATCACGGTAATTGTAT
GTCGTATTATACGACGTATTTATTTACTACACTTCTGTATGGCGTACATAACCGCCTGCGGGAAGCTTGATAAGTTCTCAGCAGGGTTTTTTTTTCAATG
TCGTAAGTTATACAACATAACCAGCAATTTTCATTAGCTCAACGTCATAAGTTACACTAGACTGCTAAACGATGGGCGGAAAAAGTGGCACATTACTCGG
GAATAGACCAAGCAGCAACGACAACAGTAACAAAAAGGAGACATTACGATTTATCAACAGCCTACACTCATCAAAGGTACGCCCTCACACTCATCTTCAT
TGTGCGCAGACCATGCTCACTCCTGATTCTCTCCCTCGTCATCGGCGTCTCCGTTGTGCAGCTGCAGTTCTCGACGCGTCTTCTTTCGCTCGCCAGGTTT
CTGACCAGGACGCCGGAGAATCACCTTTTTGCCCAGCGCGGCCGGAATCGCTTGGCCGCAATCGAAGTCATCATGTTAAATAGCAAAACAGGTCTTCAAC
TCACCTTTGTATCTGTGGCGTATCTTGTTGCAGAGCCAACATTTGGCATCGTCAACCGAGCACCGCTGGCAGTAGAAGGTTGTAGCAAAAGATTTTTTCT
TTGTGCTCGTTCGGAGCAAAGCGCACACCTTACACGACCGTTGCCGGCGCTTTTGTACGCCGCTGACCATTACCCAGTCTTCGGACTGATCAACCAGGTG
TGTGAGACGAATAGGCTCGCGTCTTCGCTTCTGCGAGTTTGGGAGAGGCGTTACAACAACATCAGCGAAATCTTCGGCCTTTAACTGCAAGAGTTGGTTC
TGCAGCACACAAATGCAATCCCCACGCTCCATCGCAGTCGTCCCAGCGAGCCTTGCTGTTTCCTTGTGGGAGATATAGGCGTTTACCAGGGCTAAGTCCA
CAAAGCCCAAAAAGAGACTCTTGTAGTACTTGGTAAATCGTGTCGACGTTTACAGAGAGTACTTCTGGAGGCGGAGTTGATCGTGAACGTAAACCCCGCC
CATCCAGCGCTGGTAATCGTTTACCGCGACCGGACACGGAGCCGTTTCAGCACCTACGCACTTCACGTTTCTCTGGATTGATGACATCGTCATAGCAGAC
CCCGTACACAAGAAATGGACCGGCTTGCGGTCCCACCAGTGGAATGCCACCATGGTAGGGACCGCAATTGAACGGGAAAACAGAAAGCTGCCACGAGGAA
TTGCTGCTGGTCGTGTCTTTCGTGGCTCCTTGACTGCTTTATCAAATCCCAGCCTGTCCGACATGATCGTGCCAACAACGTAAATACTCATCCCCAGCAA
CTCGATAGCGAGAAGAATCGAGGAATAGAATCGGTCCACGACTACTAAGTGCCATAAGTGCCGCGTTTTGCATAAAGAACAACCTGTAGATTCCGGACGA
CTGCTGCGGCGCCCGTCTTGTGATCGAATGAGCTGTCACCACCGTCTTTAGCGTTTCGTTTTCCAGCGTATATCTCAAACCTGTAAGCTACGACAAACAT
AGTTAGAGGTGATGTCCAAACCGTAACATACGACATTGAAAAAACCTGTGGCGAACCTATGGCAGTAGGCACTTCGAAATTACACAGCATAAACATTTTA
GATCCATATCTATGTGGCTTATCCGGCCTGAACATTCTCGTGGTGTTTCTCTTGGATGTGGACGGTAGGACGCCTTCGTCAAAGGAAAACACCGCAGGAA
GAGACCAGCCATCAAGGAATCTCTGCTGCAGCTTGTCCACAACTGGTCGAAGCTTCCACAGTTTATCTCGTCCATGATCTGACTCATTGTCAACAAAGTG
CAGGTCGCGCAATATGTCCTGGCAGCGATTTCGCGCCATGAACCGGCCGAAGGTGCCGGCAGGAACCGCACCATCTTCAGTCATCGCCCAATGAGAGGCA
AAACGCCGGTTTTGGGGACACAGCATACGCGCAATTAGAAGGCCGATGACTTGCAAGATCTCGTGTGTCTGGTATCCAGGTTTTCCTTGCAACCTACGTC
GATTTTGTGTGAATGTCTCTCGTGGTCGTGGGCCTTGCTGCTCGAACTGCGCTTGAGCTCGTTCGTTGATGCGTTGTTGGCAATAGCGATTTGTTTCGAC
ATTAATTGTAGCCCATAGCGACTTAGGGAGAAAGTAGAAGAAGGTCAACAGCGGTGAATGACACTGACTTTTCAGCTCTTGGACAGGCTGCGCTTCTTCC
ATGTTTAGTCCGGGGTACGACGTCACACCTTCCTCAAATGATCCAGACGCCAGGCTCCAGGTCATACCACGCAATGCATCAGCTCGCTGTTGTGTTGCGC
TCTTTGACATCGCATCAGCACCAAGCTGAAGTGACTCCACGAATGCCTCATCCAGTGCCACTGCGTCGGTTTCACTAACGACGGTATCTTCCTCGCTGTC
TTCTGCACCACCACAGCCTTTATTATGACACAGTTCGTCACCTTCACCCTCGCCGGAGCTAAAACTTTCGTACACGCTTAGGGTCTCGTCCTCTGGAACA
AAATTGACGTCCTTCTTCAGATTCGCACGTGGTCGGAGTACACGTGCAGGTGTCTGTCCAACTTCGTCGTTTCTTTTGCCGTCGCTCTCAGCTCCCGACA
CCTCAGACAGAAGCTGTAGGTTTGTAGCTGCTTCTTGGCCAGATGCCGCACCTTCCAACTCACTGTGGGAAACGTCAAAGGCTCGGGCGACTGCTGCTTG
GGAGAGGTCGGAATCGTTTTCTTGACCAAAGAGAGCATCCAACGTGTTTTGTGATAGGGCCGCCGCCGTATCAATCTGCGACGGCCGAACGTCTTCCGCC
GCGGAGTCTGAACAGTCTTGGTGTGCTGTGGCGTGTGCGATGTCGTCCTTGGCCTCATCAGTGCCGGTTTCAATGTCCTCCAATAGCCCAGATTATATTG
CAAAAACTACCACAGCGTCCTCACCAACAAAAGAATCAGCACCATCCGGACTTACATAACTCCACTCTGTCTGGATGCCACTTGGCCTCTTGGCCGACCA
ACCAGCCGCACGCAGCTGGCGCCATAGGTGCCTGAAGTCGATGTCACGAGCAGCAGCGGCAAGAGCATCAGTTTCCCCGCGGGCGCTCGAGCGTATGCGC
GCCATGGAGCAAATTCTAGAATGACTGGAACCGCTGGCCACTCTCTCAGATTCGTGTATCGCATTCCCACGAGCACCGTATATCTTTTCCGTACCCTAAC
CCCGCCCTGTTTCTGGCTTTGCCTACTTTTCCTTTCGCATCTAATTTTTTTTAAATAACTTGGTTAAAGTATTGGCTGAGCCATTCTCTATTGACGCACG
GTCTACGTCGTAACTTACGCCATAGCGATTTTGCTATGGCGTATCTTATGACCTTGGGAACGGAGGGGTTAATAGAAAAATTCCACTAAAATATGAAAAG
AATGGACGTTGCCAGTTGTTGGTATTTCCTGCTAGATTTAATCAATCTCGATAATTTTACCTGCGTGTATTAGTAAACCTCGAGTCATCGATTCTAGGCC
GTTCATTTCACAATTGTAAGCTGTAAATTAAGGAGCCAACACAATAAGACGCCCCGAATAAATCCCTATTCACTTTTTCACAATAAACTCAGAAATTTTA
ATTTGTACGTTTCAATTTGTGTGTAAAAGCAACATTTAGGATCTATTTCAGAGCCAAGTATAGTATTTCCCGGGTTGAAATTCAACGTTGTCAGCACAAG
GCAAACCCGCAGGAACTTTAGCCTAATGTATTTAACAGAAATTGAAGAGTGAGCGGAGGCAACGAGCCTCTGCTCAAAGAGATTGAATCCTTCTGGACAG
AGCTTCTAGAAGCTGCTGCTCGCCTAGCATTCATCCCTAAGGATACATGTAGCTAGATACATAAGTTCCAAGTGCAAGCCAAGTCAGAAAGCTTAGGATC
CACTACACTGCCC