Description :
From Genome Similarity Track
Location :
Scaffold_18:128255- 130069
Transcript NameFunction/comments
Aphas_H257_08188ATP dependent RNA helicase

Sequence
1814 bases(100 bases per row)
CTCATGGAAGCGATTCTGCACAACCAGGTGCTGGTGGTGATTGGCGAAACCGGATCCGGAAAAACCACCCAGATGACCCAATACATGGCCGAGATGGGGC
TCACCGCGCACGGCATCATCGGGTGCACGCAGCCGCGGCGGGTAGCCGCGTCGTCCGTGGCCAAGCGAGTGGCAGAAGAGTTTGGGTGTGCGTTAGGCCA
AGAAGTAGGGTACTCTGTTCGATTTGAAGACGTCACATCCCCCGACACGGTCATCAAGTACATGACCGAAGGTATGCTCATGCGCGAGTACTTGGCCGAC
AATAGGTTAAGTCGATACTCTGCGATCATCCTTGACGAAGCCCATGAGCGCGGGATCAACACGGACATTCTGTTTGGGCTGCTCAAGGCATTGCTCCCCA
CGCGGCCAGAGCTCAAGATCGTCGTGACGAGCGCTACATTAGACGCTGAAAAGTTCTCCAAGTACTTTTTGGAGTGCCCGATCTTTACGATACCTGGGCG
GACGTTCCCCGTCGAGATTTTGTACACCAAGGAACCTGAGGCCGACTACTTGGACGCTGCGCTGATCACTGTGATGCAAATCCACTTGTCTGAACCTGAA
GGCGACATCCTTGTGTTCCTCACGGGCCAGGAAGAGATTGATACTGCATGCGAAGTGTTATACCAACGGATCAAGGCACTTGGCGCGCTCGCGCCCGAAC
TCATCATCCTCCCCGTCTATGGCGCGCTGCCGTCCGAGATGCAGACGCGTATCTTTGAGCCTGCGCCCAAGGGTAGCCGCAAATGTGTCGTAGCTACCAA
CATCGCCGAGGCTTCGCTGACCATCGACGGGGTCTACTACGTCGTGGACCCAGGGTTCTGCAAAGAAAAAGCTTTCAACGCTAAAGTCGGCATGGACTCG
CTGATCGTGGTGCCGTGCTCGCAAGCCAGTGCGCGGCAACGAGCTGGCCGCGCCGGCCGCACCGGGCCAGGGAAATGCTACCGCCTGTACACGGAAAACG
CGTACAAGAACGAAATGCTGCCGACGGCCGTGCCGGAGATCCAGCGATCAAACCTTGGCATGGTCGTGCTACAGTTGAAAGCGATGGGGATCAACGACCT
GATGGGGTTCGACTTTCTGGACCCGCCGCCCGTTCCCGCGATGGTCAGCGCCATGGAAAACCTGTACGCGCTCGGCGCCCTCGACGACGAAGGACTCCTC
ACGCGGCTCGGAAAGAAGATGGCTGAGTTCCCCATGGAACCGCAGATGGGCAAAGTGCTGCTCACGAGCGTCGTGCTGGGGTGCGCCGACGAGATCCTCA
CGATTTTGAGCATGCTCTCAGTGGAAAACATTTACTTTCGACCCAAGGACAAGCAGGCGGCGGCCGACTCGAAAAAAGCCAAGTTCCACCAACCTGAAGG
CGACCAGTTGACACTCCTTGCCGTGTACGATGCATGGAAGCACGCCAAGTTTAGCAACCCATGGTGCTACGAAAACTATATCCAGGCCCGCGCCATTCGC
CGCGCGCAGGACGTGCGCAAGCAGCTGCTGTCGATCCTAGATCGATTCAAGATGCCAGTTGTGAGCGCGGGCAAGAATTATAACAAGATTCGACGAGCGA
TAGTATCGGGGTACTTTGCCAACACGGCCAAGAAGGATCCCCAGGAAGGGTACCGCACTATGGTTGAAGGCCAGCCCGTGTACATTCACCCGGCGTCGGC
GCTGTTCAATAAGAACCCAGAGTGGGTCATCTACCAGGAACTGGTGCTCACGACCAAAGAATACATGCGCAACGTGATGGCGATTGAGCCGAAATGGCTC
GTGGAACTCGCGCC