Description :
From Genome Similarity Track
Location :
Scaffold_98:12824- 13827
Transcript NameFunction/comments
Phyra_83841serine protease family S28, putative

Sequence
1003 bases(100 bases per row)
GCAGAAGACGCCAACCAATGGATCGCAATTGGGGGGTCCTATCCGGGAGCTCTGTCCGCGTGGTTCCGTGTTGCCTACCCGGATACGACGGTAGCGTCGT
TGTCGTCGTCGGGGGTTGTGCAGCCGGTGTACAAGTTCCACCAGTTTGACGAGCAGGTGGCTCTAGCTGCGGGTCCTTCGTGTGCTGATGTGCTGCGCAT
GACAACGGCAGCTTTCGAGAAGGAGATTGCGAGTGGCAATGCGACCACGGTGAAGGGGATGTTTGGCGCAAAAGATTTGGCTGACGCCGATTTCTTCTAC
ATGATCGCGGACGCTGCTGCGATGGCTGTGCAGTACGGACACAAAGATATTGTGTGCGTCAGCATGGTTGGTGCCTTTGAGCGCAACGATTCGCTGGTTG
ACTCGTTTGCCAGTTTCACGATCGACATGTATGGCGCTTCGTTTGGCAGCGGATGCTTCTACGACACAAAGTGTCTTGCACACGACAGTGCGCGCTGGGG
GGACGGACGCTCGTGGCGCTGGCAGAAGTGCTCGCAGCTCGCGTACTTCCAGGTTGCCCCCAAAGAGAAAAGCCTGCGCGCTGCAATGGTAGACCTCGAC
TACCACCTGAAGCAGTGCAGCCTTGTTTTTGGCGACGTCGTGCATCCGTCCGAGGGCGTGGAAGAGATCACCAAGCTGTACGGTGGAGACCACCCGGATG
GCCACAAGATCTTCTTCTCAAACGGTGGGGATGACCCGTGGCAACGTGCTTCGGTGCTCGACACGCTGTCTGACGATGAGATTGCTAACTTGGCCAAGTG
CGACTTGTGTGGCCACTGCGGTGACCTGCGTGCCAATCCGAATGTGCCCGAGCCGTTGAAGAAGCAGCGCGAGCAGATTCTCGAGTACCTGGCCAAGTGG
ATGGGTGTGTCTGATGCCGTGGAATTCGTGGAGAACGTTGTGCACGAGGCAGTCGCTATTCCTCATCACGCGCAAGACGATGAAGATGGTGCGCAGGAGA
TGG