Description :
From Genome Similarity Track
Location :
Scaffold_11:128210- 156027
Transcript NameFunction/comments
Phyke_g1500hypothetical protein PHYSODRAFT_302237
Phyke_g1501conserved hypothetical protein
Phyke_g1502hypothetical protein PHYSODRAFT_505989
Phyke_g1503Mitochondrial Carrier (MC) Family
Phyke_g1504phosphatidylinositol-4-phosphate 5 kinase-like protein
Phyke_g1505hypothetical protein
Phyke_g1506conserved hypothetical protein
Phyke_g1507conserved hypothetical protein
Phyke_g1508conserved hypothetical protein
Phyke_g1509hypothetical protein PHYSODRAFT_315997
Phyke_g1510lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, putative
Phyke_g1511hypothetical protein PHYSODRAFT_315999

Sequence
27817 bases(100 bases per row)
GGCGGTGACGGCATTGGACCGGGTCCGGGATGAGATTGAGATCATGCGAGGTCTGTATCATCGCAATATCGTGCTTCTATTTGAGGTCATCGAGGCGGAC
GACAGTGACAAACTCtacatggtgctggagcacatgACCTGTGGACCATGTATGATCTACAGACCGGAGACCAAGGACTTTTATAGTCGTGTTACAGGCG
GAACTTTGGCGGAGGAATTGGTGCGTGCCTACTTGGCTGATATCTTGCTTGGACTGGAGTACCTTCACGAACGGCGGATCTGTCATCGTGATATTAAGGT
GAGAGGGGAGATATGTTGGCATATTGCTGTGTAGTACTTCTGGTCCTCATTTATTCATTGTTGGTATGTGTTTGTAGCCGGACAACGTGTTGCTGAATGA
CGCGGGGCGCTGTCACCTGACAGACTTTGGTTGCGCGAAATCATTTGGCGACTTGGACAACGCGCCTGGGGAAAGAATAGGGGCTGGGCGATCGGCAATT
TTGTCCGAGCCGGcgctagtgacggacacGGTTGGAACGTACCAGTTCCTGGCACCAGAGTGTTGTTCTGGTATACCGTATGACCCCTTCAAGGTAGATA
TATGGGCCGTAGGTATCGTTCACTACATTTTCCTGTTCGGGAAGCTGCCTTTCACGTCGGAAAGCACGCGGGAACTCTTCGACGAAATCGTTCGTGCGGA
AATCATCGTGCCTGACGAGAAGAATTCTGGCAGAGAGCAGCGAGTTAGCCCGGAAGGCCAGGATTTGCTTCAGAGGATGTTGGAGAAAGATCCAACGCAG
CGTATCACAATTGCTCAGGCCCTTACGCATCCATGGTTTGTTCAAaaggaagacgatgaggagcCTCTATCGTTTTGATGCGCATAAGGAACCTTGGCAA
AAAGCTGCAAGCCTCTCGTTTTGAAGTTATGAGTACTGTTTTCGACGGACTAGTTTGGTTGTCAAGGGGCGAGAGTCTGAAGCGTTAACCTTCTGCTGCG
GTATCAAGTATGTTCTGGTTTATGGCCAACGTATCGATAAAGATTTTCTTAGCAATGTACCccggaagaagctgcatgTTTTTATAGGATGCTGCTCACA
AAAATGATATCCGTGTCGTATTATTTAATGGCCTGGCCCACAGTAGCGGTGTGTTCGACCTGTATCATTTTCTCGTTGTAGCACTCGTGTAGCATCTGAT
GCGTCAGCTGAAACATCTCGTGGACATGGACACCGTCCATGCCTCCACCAACAAATGGATCCTCCATGGCTTTCTCCACATTGAAAATGCCAGTCATCAA
CAAACTTGTCGCGATGCTGAGCATCAGGCAGAACCCAAAGTTCGTGGCTTGACTACCGTTGCCTCGTGCGATGTAGGCGTAATATGGTCCGTAGAACACT
GGGAGCACGAGAATGAACAGTCGTGTGAACGAGCGGGTAGCTTGCGGCGTTCGGTAGAACTGGAACAGCAAATGTCAAAGTATTAGTCAATACTTCCTAG
TTTCACTGGTCAGGCAGAAACGCACCTTGATATTCTGGAGCTTTTCGATCCGAGCTTGGAGCAGCCAATGGTACTGGTTAATCCGAGATGCCTCATTAGC
AGGCATCCCACAAAATTTCATCACTTCCACTTGTTCATGTAGCTGACGAATCGTGTTGACGATCCGCAATTGCAGTTGGTTCACAGGTGTTGAATAGCTT
AGTGCTAGCTTCTGTCCGTGCGAAGTGAAGCGATGGCGTCCACGTGTCAGCGTCGGCATCAGAAGAAGGGCAATCGTATCATGTAGCACTGCTTCTAACA
GCAGCTTTGTCTTCTGCACATAGTCCATAGGAAGCTTTCGCCGCCCATTGTCTCCCCAATTCCACAGTGCATTTGCAAGCATGATATTGACCAGCAGAGC
TCTCGCTACACAGGGGTAACAGCAGCATTGAGATAAGTACCATCCCATCCTATCATTATCCGATAAAATACACCGCTTACCTTCTGCCATCGCATCCAGA
GCTTGCTCTCGACGTAAGAAGGCCTGTCTGATCTGCATGATCATTGGCGACACCACCGCGAAGGACACGATGGTCCACGAGATGTTGGCGCCGAAGCTTG
GACCGCCCGAGCTGCTTTCCCCCAAGAAATAGTACAGAGAGGTTGTAACCACTGCGAATACCACCACAAACAGGCCTTCGAAGGTGATGAGCTGGATGCA
AAACACTTTGGAGGCAGCGTACAAGTCCAGCACTGTGTCCCTAAAGCTCTCTTTGGTGCGTTGTATCGCATCCTTCATCGACATATCATCGTTGCTATTG
GACATCCCCACATGTTCGGATACAGGAGCTGCGCGTCCACTCTCGACGTTAGTGTAGGGTCCTTGTGTCGCTGCATCGGTACCGTACAAAGCATAACCGC
CGGTCATTGACCTGATCTGTTCACGATTCCGCCGCTTGAAATGTGACAAGACGTGGGTGACAAGTTGACACCAGTGGTACCATAATGGTACATTGACGTG
GTCCACATGGCTCGCAATTTTGCAGCCATTGGGTGATTGACAATGGAGACGAGAGCTAGCGGAGCTGTGGTGGGCATCGAAGAGTTCGTGGACAACAATG
CGAAGCGTCTAGTTGTGCATGGTCGCATTAAAACAACGTGCGTTTTAGTTGCAATATTATAACGGTTGTATTGGAATGGTAGAGCTAAGACTGATGATTT
TGTTGGTACCTTTAGGCCTGAAGATTTTGTGGTGCGCGAGATCGATGTGACTGGTGTAGTTGTAGAATTCAGTGGTGATAGCGAACGTTTACCAACAGAG
CATGAGCGTGAAGAAgtgatgaaggtgcttgAGGCAAAGCGTGCAGCCCAgaaagtgaagaaggagaaattggTGTTTGAAAGACCGGCAGGTGGGTGGC
GATCGGCACTAACGGAGCTgattggagctgaagaagcgaacAAGGTTGAAAGCGTGGCAAAGTGTCAGGCTGATGGATGCTTTCTTCTTTCGCCTGAGGA
GTTCCAGGACCGTGTTTACCTACAAGTTTGCATCCAGGTATTTTACAGCGCGTTCGGTTTATAGAGCTGTGGTGTTGAGTTCTGATCTTGTTGCATATAC
GACAGAATTGCTTCCCAGGACTAGACTGCAAGATGCAAAATGCATCGACACCGGAGGATCAGGGTGGAGTACAACAAATCCACGTTTTATTGGATCCGGT
GTACAAGAAATTTCGAGATGGCGGGATGGCTCTGGAGAATTGCGATCGCTTGCTGACGTTTCTCCGGAAAggagctggtgatggtgcagcaTCGAAAGGT
ACCTAGCCGTAGAGCTTGAAATTTCAGTGTTGTTATTGTGATTGGAAATTGTTGATGATTATATGAACGTATGGATACAGGTCTTGAGCTCGAGCACGAG
GACACGAAAGAGGCCCGCACGGCGTTGCATCGCTTAATTTCTAAACATTCGTCGTGCTtcaagacgaagacggaAACTCGGAATGGTGTACAACGACTTG
TGGTGCATTTCTTGCCGAAGAGCAACAAAAAGCGTAAACGCTCGCAGCCACAAGTCTACCTCCAATTCACACTTCAAAAGGTAAGCTGCTTACCATAAGC
ACCTTTGTGTAGAAGTATTTCATCTATGGCACCTTGATTTACATCCTGGGATTTTTATTTGTAGAGAAATCAAGAGCATTTCACCTGCTTCGACAAGCTA
GCTCGCAAACTGAAGAGGCCGGTATCAGCGTTTTCGTACGCCGGGACGAAGGACAAGGCAGCTATCACTTTTCAGCACGTTGTAGCCAGTGGAGTGCCAC
CTGATCGGCTGCTGAGTATTGATCGAGCCGCAGGCGATGGAGTAGATGGAGTCCAAGTAGGGGATCTAAAGTTTGTCGCCTCCCCGATAGCTTTGGGTGG
GGCAAAAGGAAACAGGTTCACCATTGTGATTCGGGGGCTTTCATGTGACGAGGGATATGGTGCTGAGACGATTCGCCCGGCACTCGAGTCCGCTCTTGAA
AATATCAAGGACCAAGGCTTTGCCAACTACTTTGGCTTTCAGCGGGTTGGGCTGTCCACCAATGCAGTAAGGTCTCATCATATTGGAGAGAAAATCATCG
CTGGCAAGTATGAAGACGCTGTGAGGCTTCTTTTGGCATTTCAGGAGGGTGATTCCGAGGACGCGGCACGCGCAAAGCAGATGTATCTCGAATTAAATGA
TGTTGAAGCCGCGATGAAACTCATGCCACTTGGTCTTTCCGTCGAGCGCCAAATTCTTCAAGGACTAAAACGTTACGGCTGCGACGCATTTGAGCAGGCA
GTGAAAAATGTGCCATTCTCGCGCCGTGTGATGTACATGCACTCGTACCAGAGTTATCTGTTCAACCGGATGGCATCTTTCCGACTGCGTCACTATGGAG
CTAAGGTTGTTGCAGGCGACCTCATCCAGTGTGACGGTCAGAGTGAAAGCGCTTGCCCAGTGAAGATTGTTACTGTTGAAGAAGCCGAAACATTGAACAA
TGAACGGAAAGATGCATTGGCACTTGTACTTTTGCCACTTCCCGGCACGAAAGTGATGCTCCCGTCCAACGCCACGAAGGCGGCATGCCTCAAGGTTAGT
TTTTGCAATGAGCATGCTGATACATTCTTGGTATCTGACAATGTTCCTatcgatgttgaagttgatggagGACGGCGGTACGAAGAACGCCCTCTGCGAA
TCAGGACCGGTCAAGGGCGCGTACAGATCGTTGGTCTCGTTCCCGCATGATCTTGAGTGGGTATgggaagaagatcaagacaAAGGTTCGTGCACTTCAA
GCCTAGAGCTGCCATTTTTGCGTCAACCAGCTTATTGACGTCTGTATGTTTTTCCAGCAGCGCTctcgctccagctctcgtTCTCGCTGGATAGCGGATG
CTTTGCAACTATGTGTCTACGCGAGGTGCTCCGATCAGACATCTAAATGCACAGGTTTGCAGCCAAAAACAACAGTCCATTCATTCGTCATTATTCGATC
CGGCCGTGTCCTTCGTACGTGCCGCTACTGTAACTTTGTTGCTCCAATCGTCCTCCAACAACGACGTTAAACGCAACACAACATGGCTCTATTTCTTGTT
CTCCATGTCCTCGAGCGCCTGGCGCACCAACTTGGCGCCCGTGACCATGAAGAGCGTCTGCCAGATACCCAGACACAGACGTGGCACAATGCCCTTGAAC
AGTCCACCGTATCCCTGCTCCTTAACCACCGTGCGGAACACTTGCATCATGTTTTGCTTGGGTTCACCACGATCAGCGGCCGATTGCATCTGGATACGCG
CCACCTCAAACGGGTGGTTCCAGCAGGCCAAACCACCACCCACAATACCAGCCCCTGCCTCCTGAGCCACCGTGAGCTTGGCATCCTTGTCATCATGGAA
CATGATCTTGAATTGGCCACGGACAATCTCCGTGAAGCCCTGACGCGATGCCCAGTTAGTCGCTTGACGGAAGGCAATGGCAGTGCCGCCAGGATAGAAG
CCCTTGATGCCGTGAGCTCCGTACACGTTGTGGATACGCTGCGACGTCGTGATGGAGCGATCTCCCGTCACTGCAGCCGTCACTAGGAAGGTGCAAGGGC
CCATGACCACCACTTGGCACACACCGCCGCCTGCACCAGCCAAGAACCCCGTGAGCCCTTGGCCCACACCCGCAGTCAGCAAGGAGTCCGAAATGGCCTC
CTTAGAGAACAAGAGGATGGCGCCCTTGGAAGCAGACTCCACCATCTTGGGCCCAGTGCCAGCCCAGAAGGCAGAGATGCCGCCGCCCTCACGCATCACA
TTCTTGAAAGCTTGCAGTGTGGACTCGTTACGGTAGCGCCCCATGCGCGTTTTCCATACCTCGAAGGGCATCCCCAGCGTTGCCGCCTCCAGACATTGGA
GCAGACCACCGTTGAATAGGTCGCGTGGACCCACTTTCTTGCCGGACGTGGGTGGGGGAGACATCTCCAGTGGAGAAATGAGGGGGACTGTCGGAAGATC
CCTTAGTTGGGTCCGTAGAGTCAAAATTGAGATGTGACGTCGAGTTAACTACGTTTTAGACGCCGATGACGCTAATTCGGAACCAGGTTCAAGTAAGCAG
GCAAAAAGATGCCGAGCAAAAAGAGGGCATGACGTCACACTGTCATGACGCAGCCATCGGCGATTTGCAAAGACCACAACACTCCAAGTGACCTGCATGC
GCAATGTGAGTGCAGACAATTAGGCTAACTAGCTCGAGACAACCAAGCAGCTGCCGATTGACATTGATTAATATCATAGACAATGAATTCCTATGGTGAT
ACTAGTAATCCTCACCCGCGCGAAGATGTCCAGCAATgatctgacaaccgtctagaGCGCCACCAGAACAAcctttttgagttgcgttagtttcgttgag
acctgcaatAAGCTGGCAGACGTGGTAGACCGCGCAGTAAGCGTtgaaacatcagcaaaatGTTCCACGAAGTATTGACATCGCGGTTGACGGTTGCACC
AGtgtagaacagagtaaaccttccgcgagcgcaccacaccatcacggcgctcacgacgctgatattACTGAGAGAGGCCTTGGGGCATCCAGTTGGGGAA
CCCGTATTGCCCACGACTGGCGCGGTACTCGTCCTTGGGCTCCGCGCGACAGTACTTTTGGAGCTCTCTCCCCCAGACGCTTTAATGGTCCACCACCGTg
tctgtgcagctccagtcgccaaATCCCACAATCATCCGAGATGCGCCTCGGCCTTCAACGTAGAGCCCACAGAGCTGATGTagtttcttgcgcgcttGCG
AATAGTGTCTACGTACCCACGtttggcgctgctctcggCCTTGTTTGTAATCACTGGCCCCTTAGATGTTCGCcgcttcttcgttgccgtTTGCTCTTGG
CGTGCTGGGGCTCGGCGCTTGGAGCCTGCACCacgtcaacttcaaggtgGAGCCGAGTGCACGGCGCCTCCGCCTGGATGCCATGTCCGAGGCTAATGGG
TGTGTGCCCAAGGCAGTTGACTTGTTCACTATTCTTTCATATGCGCACGCTCAATATTCTCAAGATATGGTGTCCATGTTTTTATGGCGAGGAAGCATCT
GCCTTGCAAAATAATGTATTCAATGGGCGTCGCGCGCCCACGACGGCCAGTGGTGGCTCGTACTCGACGCATGGGGAGCTTGATTGGCGTTCAGCACTCG
TTGCAGATGTCGGCCTCCCGTAGCAGAACCGACGTCGAAATGCAAGCAGACAGCTAACGGCAGCTTGATATCAtgagcagcaagtggcaaGTGCAACATG
GCAGTAGCAACGACATCGTTAGAGACTGTAGTCGCAAATATAAAATTGTCTTCAATTCGTTCACGTTGTGAAGTTGGCTGCAACAGTAACATTGATATGG
ATGGACATTAAGCGGAGTGGACAGCCAAAACGGCAAAGTTCACGTTTCCTCATTTTTTACGAACAATCTACCTTCACCctgccgtccttgtcgttgCCTA
CAACCTATACCTCATTTTCTGTTGGAACTTATTAAATACAAGGTATCTGTCCCATTTTACCATTGCTGGACCTTTTTGGTGTCACTTTTTCCACGCGAAA
ATACCGCTTATttatgtggtacacacaaTCGAGTCAGAAAAACAGACGGGCGTCTCGCCCTCGATTCTCCATTCGGCACGACATAAGGAAAGGCCACCGT
ACAAGAGCTCCTGAAGACCAACGCTAGATAGGCGCCACACAACAACGATCCATCAACCGACCCACTGCTTGAGCCTTTAAGCCCAAGCGCGTCTCCTTCG
GCGCCTTCCTAGACAGAGCGCTTTAGTGGCCTCCAGACAACCCACCAGCCTCCGTTCTTGGGCAGTGGGAAAGAAGGCGATTCCCGACACCTGGcctgct
gtttctgctgcatcatTTGGGATCGCCCCTTCTTTCCCTTGAGGCTCCGCAGTCTATTAAGCGAGACGGCTGGAACTGAATAACCGCCGACTGAACGACC
TCAGCGTCTGAAGTGTGGTGTGTGAGACTGTCTGAGCCTCGTCATTGAGCCCATGAGAAGATCGTCAAGCACTGAGACTCCGTATCGCCGCTCCCAGTCC
GTCACCAGTCACTCgcgacagcaacatcgaGGCACACccgtgctggaagagcagaacTACATGAACGCTTTCAGTCCGCCGTCCAATGGCGTGTACGTCA
TGGAGACACCCCATCAACGTGAGGGAGATGCCCCGGATGGACGACGCTCTCTGCGTCAATTGGACCAGAACGGCTCGTTCCGACAGCCTCACGGCATGAC
TCGCGGCGCCTCGGGCCCGTTCATTGCCATGGATAACCACAGcactaccagcagctccagcgccaactaTGTCGACGGAATGAGTCTCAATAACAACATG
AGCGCTACAACACAGCAACCGCTGATTTCCACGCCAAGAGCTACCCAGAAGAACATCATTCGTGTGATTGATAAGGACATGACACAGCAGTTCCGAGGCA
GGTCCAAGTCCGTGGCGCAAGGACGTATTCGGTGGTTCGAGAACAGAAAGTCACAATTGCTGGGATTTTGTTTGACGATGGCGTTTCTAGGAGTGTCCAT
CGCCATGTACAACTACCGATGGACAGGTCTTATTGCAGGGTCCGTGAACACCATCATCTGCGGCTCGGCTGTTATTATCACGTATTGTCGCAAGAAGCAA
TGGCACCAACATCCGAGCCCCATCGTGCACAACCGCTCCGTGCTCAGCATTTTCTTTGCAAtctgtttgctgctgaatgtGCTCGTCGATTTCGACCCGA
CTGGTTCTACGACCGATTGCCAAAGTCTTGCAGGTATCACggagttcttcttcttcactggaGAAGCGTGGGGTCTCGTTATGGCTTGTGATCTCTTTTT
CTCGGTACGTACTGTGATGGGATTATGTGGGTAAGAGTCATGTCTGATGTAACAGTGTGTTTTGCTTTTGATCTGCAGCTGACAAGTCCATTCACGAGCT
ACAAACGCTTGATGAAGTTTTATCACCTATGGGTGTGGCTTGGTGGCCTTGTCATGGGTATTATCACGTACACAGTACAAGGGGCCGGTGGCTTTTTTAC
CGTGGATGGTCACTCCGTGACATATGAGTCAGACACCGACGAAGTCATTGGTTTTTGCCTTGCTTCGTCGCGCGTTTGCTGCGACGACGGCGAAACGTGC
CCTGATGATATACTCCCGTGttcaagctcttctagcTTCCTGAACGCACAGCAATGGTGTGTATTTCGATGGCTTCGGGCTCATTGGAAACCCCAAACTG
ACTGGTGTACTTTTGTGACAACCTTTCTAGGCCGTGGATTTTGATTTATGCCTTTGTGCTCCTGGTATTGTTTGTGTCTGTGTGGTAAGTCTTCTATGCT
ACAAGGTTTCAAGACATGTAGTTAATAATGTATTTCTCTGTGATGCAGTGTGCTGACATTGGCCTGGCACCGACTATACCTGCGCGGCGTCCCGAAGACG
TACAATATTCGTCTTCGTGTGCTGAACTACATTTCCTTGTAAGATTGCGTTTACTTTCTGATGCTGCATACCGTGACTATGCATTTTTGGCTGACAAAGC
ATGTCTGACATATTCACTGGTACTGTTCTCTTCCCAATGATCAGCTTCACCGGCGCCTACGTTTTCTACTggttactgctgctgttgttgtaCATGTGCG
CGTACTTTTTGTCCACACAGAGCAATAGTTCGAACTCGAAGGCCGTTGCTCAAGTTCTTCGTCAGCTGGTGATTTTCCTTGTGTCGTCGAAAGGCTACTT
AGACTATGTCATCTGGTTCGCAGTGAACAACATTGAAAGAAAAGGAGAAAATGGACGCGAAGAGTCAGCAGATGTCGACGTTGACTTAAGTCCTCAGGTG
AACTCAGCCTTGAGATCGGAGATTTTGTACTACACCACATCCGGTATCAAGGAGTCTGTTCGCGCGGTGACTGACGAGCTTATCTCTATCCCAATTTCAG
GCGAAAGCGAGGCGGTGCGTTTTGCATCGCGTTGTAAGCTGTGCTATTTACTTGATATGTATTCTGATGCTCTGCTCTCTGCTACCTTTGTCTCTTTCAC
GTGTTACAGGGCAAGTCTATTAAGTTTTGGTCGTTCAATCCGTCTTCGTTCCGCAATATTCGCCTGGCGTTCGGAATTAGTGACGCCGAGTACATTCAGA
TGTTTGGTGCTACGACGAAGGAACGGTTCAGCGAAGGCCGCAGTGGCGCTttcatgttcttcacgtCTGATGAACGTCTTATTTGTAAGACCATGTCTCC
CGAAGAGTGCGCATTTTTGCGTAAAATGGCGCCCAACTACGAAGCGTACATGACAAGCAACCCTGACACGCTCCTTACGCGTTTCTACGGTTGTCATTCT
GTCTCTCTGTACGGCAAGATGTATTATTTCGTGGTCATGGGGAACCTGTTTGCGGAAACGGACGTTGTTCACCACCGTTATGACATCAAGGGATCGTGGG
TGGATCGCAATGCTAAGGTCCCAAGCCCTGGTGACAAGACTACATGTCGGTACTGCAACGCTTCATACACATTTGGCAGTACCAAGAACCAGGTATGAAT
GTCTGCTTAATTTTTTCATGGTGTGACTTTCTTGATTGCTGACGGTGGCTACATTTCGATGACAGGAGTGCGGAGATGGCATGAACTACCATGAGCCTGA
TATCGTGCTTAAGGATAATGATTTGATGACCAAGGTGAGGCTTGTTTTGTTTACAAAAAGCTGCTGTAATATCAATATCTGACGGTTTGAGTGTGCTGCA
GATTCGTATCGACCCGGGCACAGCTCATCGCATCTATGACCAGATTCACAAGGACAGCGACTTCTTGTGCTCGCAGGGTATTATGGACTACAGTTTGCTG
ATGGGCATCCAGAGCTCAGAGTTCTTTGTAGACACGAGTCAGTTCACACAAGGATGCCGcgaccagctcttcacgcaACCCGCGGCGAGCGTGGCTGGTC
CGTCACTTTACCACTTTGGTATTATCgacttcctgcagcagtggtaTGTTCTCTTGTTTTTGCAGGACTTGATGGGGTGTACCAGCTACGGTATtgcgca
gcattttgaccttgttgtgatgctgttttttcttctttaGGACAATGGAGAAGAAAATGGAACGCTTCTACAAGACTTTCGTTAAACGCAAAGACCCTGA
CGGTGTCTCTGCTCTCCCTCCGAAGCCGTACAAGTTCCGCTTCCAGCAGAAGATGTCACGCATCTTCGCGCTGACGACTCACATGCGTGCTGAGAACACC
ACCTTATTCAATAATTACCCGGCACTGATCGATGTGCTAGACCAGGGTAATTATGACACGCAGCGTCACAACACGTTCGCCAATATCTCGGAGGTGGAGC
GACGGCCAGTGTTCAACCCAGACCAGCCGCACGATATCCGTGCTGTCTAGCACTGTTATCATCTACCTACCAACTCCTGGTAAGTTGAGCcgagaaagag
gagaagggAGGTCTTCAAAGCGACGCGAGCAATTCTAGGATATTGTCTGCAACGTCTCGCGTTGTAAAACCAAGTAAGAAGAGCATTTTATAATAACAAG
CGTTTGTCAGCATCATGCATGTGCTCGCTATCATGTCAAAGGTTCGGTAAATAACGTCTCCCTGCTGTAttatttcagccaatcgtATGGTCCCACCTAT
CAGCTCCCCCTTCACATCTGAAGTCCGAGCCAAAAAGACCTGCTCAATACTTCCAAGTATGGTGAAGGTGCGTCTCTACGAGTCTCTTGACAACTGTTAA
CAATTGCCACTTGCATATAAGCACCTGGAAGGTTTAGATCACACACTTGTGGATGATATTAACCGGTTGAATGCGACACGGACGTGATGCAGGCGACGTC
TCCGAGCGTGAAGGCGATCTTTATCCTGGACAGCGATGGCAATCGCGTGTGTGCCAAGTACTACGACAAGTCGTACCCGACgcagaaggagcagctcGCT
CTAGAGAAGAAACTGTacgccaagaccaagaatGCCAACGCGCGTCTGGAAGGTGAGAGCAGCCACAGTTCCTGAATAAACAACTTGAGAACGAGGAGAA
CTGTTTCTAACTTCTGATTGTGCCTTTTCCTACTGATATTAGCCGATGTTATCCTGGTTGAGAACATCGTCAGCGTCTATCGATGTGGCTCAGATACTAC
GATGCACGTGGTGGGATCGGCTTCGGAGGTACGAGAGGGGTAGATTGGGAAACTAAGCGGAGGATTGCTGGTTTTGACCTGATGATTTGGCATGGTTTTG
TGTACTCTTTGCAGAACGAGCTTATTCTCCTGAACGTCTTGGACTCGGCCTTCGACGCTGTTAGCAGCTTACTCAAGTTCGTAGTCTGTTTCAGTTTAGC
TTTTCTTGAAGGTGTGAGAGCTTACAAGTAGTGGTTGTGGTGGGATGACAGGGGACGGATGGATCGCCATGTGATGTTGGACAACAtcgagctggtgctg
cttacgtttgatgaagttgttgatggAGGGTACGATATATGCTTGGATTTACGTGTGCTAGAATATGTCTAAACGGTTATTTCGTTGTGGATCAGAATCA
TTTTGGAAGTCGACACGCCGTCCATCTCGAACCGTGTACTCATGCGAGTAAGTTTTGTTGACACCGTGGCTATCACAGAAGTGAAGACTTTGATTGGTAT
TTTCATGAGTTGAACGTATTGACATGCTGCTACTTGAATTCATCTTTTTTTACTAGGGCATCGACAACGAAGTACCGATGGCAGAACTCACGATTTCACA
GGTGGGCTATAATGCGACAAGGAAGTCAATTATGGGTACATTCCTGACTTATACATGCCTTTATCGTTGTCTCTTTTTGTAGGCGTTCGCGTCGGCTCGC
GAGCAATTTTCACGCTCCTTCCGCAGCTAGACGGCATCTTGCATTGCCACACTAACAGTGCTTCTCCTTGCTTTTTCTATCTGTCTCCTCAAACACGACT
CCGTTGTGATTTCTTCTCCTCCCTCAAAGCCATTGCGAAGTATATCGTTCAGAAGTTTGCATGTAATGTTGTCATTGTCGCCTTGCGATCATTATTTAGT
GCTCGTTAGCTATTTTGACTACCAGTAATAATTTCATTTGACTACTTCGAAGTCATAATAGCTTGTCAATACCTATCAGTGAAACTTAGCTTTTTATATT
GAGGACTGCAGTgatgaaggaagaggagcaggagcagagtGCTCCCTGGGGGAGATTCGCACTCGTGTCCAAGGATCCAGCCGAAGAGAGCGACCACATC
TATTTCTCCAAGAAAGTGACTACGATCGGGCGCAACCCGCGGCGCTGCGACTACGTCATCAACCAGCTCTTTATCAGCAGCATCGTACGAACAATTCCAG
CGCTAATTGACTATTGCAACTGATTATAATAAGGGTTTTACTGATGGCAATTAAATTAATGATTGGTTGAGTGGGTAAAATAGCATTGCGTTGTGCAGTT
GGAAGGAGTGGACGACGCTGGAGAGCCCCTAATCAAGCTGAGTGATAATAGGTTGGTGGGGGTGGTTCTTAGCGGTGATCGAGTGGGTTGGGGGGTACTA
ATTGCTGTGGGATTTGATGCTTTGTGATTGTAGTCGCAATGGGATTTGGGTGAATGCAGAACGCATAGGCAAAGGATCCTCGGCCCCATTGGGTAACGGC
TTCACGGTTCACTTCACGAAACCAGGGACGACACCGCCAGGTTCAGAAAATGATAATATTGCTGATGATATGAGCGTGGGTGTTTTTATTCGCTAACGTA
TTGCATTGTGTCACCTCTATATGATTGATTCGGCAGGTGTCACCCCAATGGCTTATAAAGTTGAGCTGCTGTAAGTATGAGTGGTTGGTTGATTAGCTGT
AGTATCAAAACAAATTCTGGTGGACTAACGTTTttgcacttgttgtttttgctttggcAGTACCATCAGCACGCCGGATTCGCAAAGTGAAGTGCATGAA
GCACAGGCGAACAACAGCTTCAATACGACGCTCGGTGGCGACGAAAATTTCGAGATGACCCAACAGGCTGTGGTGGGAGAAGCCAGCACAGATGCTACCT
CTGAAGTTACCTCTCCATCGGAGAAAAAGCGCAAGCGTGTGGACCAAGAGCCTGCTGTTGTTCCAGTGACTTCGCAAGACCTTGAAGCTAAACTCAAGGC
AGCGGAAGCCAAACTCAAGGCTGCAGAAGTGCAAGTCAAGGCTGCAAAACTCCAGATTAAAGCTGCTGAAAGTAAGGTTGAGAGTATGACAGAAGAATTG
GAGAGAAATATGCGTGCTAAACTGAGTAAGGTCGAGCAAGAAAGCATGACCTTGATGTCAAAACTGGAGGAAACTACAGCGGAGAACCTGAAACTGAAGA
CAGATCTGGCTGCGAAGGCTAAAAACCTGGAACTGAAGCTTGAGGAAGCGGCTAAACAGTATAAACGCGATTTAGAGACCAATCGTGACGCAAAATCCCA
AAACATGGAGACCAAGCTTAAAGAAGCCACTAAGAAGTTTCAGCAAAAAGTGGAAGCGGAGCACTACGAACAGCGACGAGAAATGAGCGAGAAGATGGCA
GCTTACAACAAAGAGAACTCGCAATTACAGGCGACTGTGGTTTCAAAAGTGGAAGAGCTTGCTGAGTGTGAGGATACAATCACCACATTGCGGGAGAAGA
TCAGCGCTTTGGAGGAACAAGTAAGCGAATCGAAGTCAAAGGTGGATAAACTACCAGAgtacgagaagaagatcagTGAATTGAGCACCAAGGAGACGGA
GTTGGCTGAGTGTGAAGAGAAGATCAgtgaactggaagagaaaaTCACGGCGTCCAAGGATGAGAACTCAGAGATAATTggacttcttgctgcagctgaa
gaaaaAGCTGCCGTTGCTGAGGAAAAAGCCTCTCgggctgccattgctgctgcagcttctgccagcatcatcgcAGATGCAAACGAGAGGCGCGATCTGC
AAGCGTCTATTGTATCTTTTCGCAGCGAGCTTGAGGGGCACCGCGTCCAACTAACGAGATGGGAAGAAGAGGTGCGCAGACGTCTTGtgccatgagctgc
tgcctgttGGTGTCTAATAATCTCTTATGTTAATTGATAATGCTAGGCCAAGAAACAGCGTGAAGCCACAGCGCTGAAGACTGCTGTTACAGCCGCGACA
GTGGCGATTCCCGCACCAAACGTCAATTCAGAAAGGTAGGGCATACTATGCTGGAATCGTTGCTTTCCATGAACAGCTAGTGAATGACGTGCTGTGTGtt
ctacttcttcttgtctaCCAAAAGCACCATTGCTGccgatggtggtgatgctgtGACGTTGCGGGCCCAactggctgctgcattggaTCTGTTTGGGCAA
GTTCAAGCTCTCGGTCTCCGTGGTATGGAGCAGCTCGCCGGATCAAGCTCTCAAGCACTGGGAGATCTCCACCTCTTGTCAGCGGCTTCCTTGGAGTCTG
CGTGCACGAATGCTACTATATCAAGTTCATCCACGTCTCCTACAAAGTGCCAGGAAAAGGATGCACTAGTTACGAAAGCCGACAAGAAACCAGCGACTGA
CAAGACGAAGAAAGTTGTCATTGTCCATGACGACATCGATCATGCATTAGCGGAGCCCAAATCGCCTTCCAAGAAGATGTgggagaagaagcgagctAAC
AAGCAAGCTGCACCGCTCTCTGCAGTGATCGAGACGAATGCTGCCTCAGCCATCGCTGCAATGGCCGCAGCTGCGGAAAGTAGCGCTAAGAGCTCTCCGA
GTGACGCAAGCACGGCAGTCGTGAACGATGACACACGTGACGGTGACTGGGAAATGCTGAAGTGACCAACCTGAATTTCAGCGATATGAAGAGCGACAAA
CAACTTTGAAGTTCGCAGAAAATACTTAGTCGTGGAAATGTTGGCAGACCTTCTTGCTAACTTTGTGACGTATTTTTGTTGTGAGTGCCATCCATTTCGT
CGGCAATCAATAATTGTGagcaccaagcagaaggcaACATGCAAATCACAACCACGTATGCACGACAGTTACCCATCATAAAACAAGATTCAGGAGGGTT
GACATAGAGCAATACGAAATGCCTGGGCAGTAAACTGACCGTATTTGCTCATTAAGTGTTAACTATCTGACACATTGATACAGGAGGTCATCTCTCCTTT
ACGACGATGGTGAGCTGTAATTTATTACTACTATTTGTATGCTTTCCGTCCCTAACCCCTCTCAAGATActtgtttttgctgcttaGAGTACCAACAGAG
TGCGCTCAGTTTGCGTCTCGCCCTCAAAGCCACACAAAGGCAGCACCTCCTGTATCGATCATGCTCCGCACTGCTCTCCGTCTCCGTGCCGCCGTGCCGA
CCCAGCGCCGTATCGCCGTCTGTGCTGCACgcaccttctcctccttcccGCCCCACGAGGTCATCGGCCTGCCTTGTACGTCCGCCAACTAACGGTTTAT
ACACAAACTTTTGTGAGCACAAATTGACCATTTTGTGATACATTTCTATTGATTAAAATGCAGCGTTGTCGCCCACTATGGAGACTGGTAACATGTCCAA
GTGGAACCTGAAAGAAGGTGATGAAATTACTGCCGGCAGCATTGTGTGCGAGATTGAGACAGACAAAGCGGTCGTGGACTACGAGGCCACGGACGACATG
TTCCTGGCCAAGATCCTCATCCCGGAGGGTGCTGAGAACATCCCCGTGGGTCAGCCTatgatggtggtggttgaGGAGCAGGAATCTATTGCTGCCTTTA
AAGACTTTAAGGTGGAGGATGCCCCCGCCGCTCCTGCCGCCCCCGTGCTTTCGGAAGAGGAGAAACCCCCTAAAAAGGAGGACGTGCCCGTGGACGCCAA
GACCCAGGAGCCCGTGGTGCCCCAGGACTTCCTGGTGACCTCGCAGACCCCAGTCAAGACAGTGGCTGGCCCAGCCATCCCGGTTGCCCCTGTTGCTAAG
CCTGCAGCCCCGAAGGCCGCTGCCCCCTCCCCGGTTGCCAACGCCGTGTTCGAGGAGAAATGGGGTCTTGGCATCAAGAAGAGTGCCATCTCCACCAGCc
tcatcaagaagcagcaggcgtACATTGCTCTGTACGGCGTTACAGGCATGACCCCCGCAGCCCTGccggagaagaagaagtaaCTTTCTAGCGCTAGGTA
GAGCAAGCACAGACCCCGTTGTTAATGCAATGCTTGAAGAAAAGTGTTGCTAATTTGTTAATGAAAACGCAGAGCTGACCCAGCCTCGTTTGAAGCTTGC
ACATGTATTGAAGGTGCACTAAGAGAGATTCTCAACGCTCGTGGCAGCGCTGCTATTGTAGCTTACTGGGGAACGGTGATACTCATGGAGTGCACTTTCT
CAAGGTGGTTGAGCACGCCGAAAGCGTCCACCGTTAGGAAGTCAAATAGTCCCGGGTGCTTCGCGTCAAGTGTCTGGAAAAGAGAGATGAGCATTGTAAC
ATTAGTAAGTCCATTTTGCTGGGTTTAAATAAAAAATCAACCGATAAGGCAGAACGCACCTGGTATTCAGCCAAGTCGATGACACCGTTGCGGTCCAGGT
CAGCGTCCTCAAACGTCTTGTCGATGATGTGCGCCAGCTGCGCTTCCGTCAGCGTGATCTCAAGCTCTGCATATTCATCGCATCAATAAACAGTACAATC
AgcaaacacacacacaaaaaacaatAACAGCGtatccaccagcacaagaCTGCCAAAAGTCATCCCCGCACCATTGCATTCTGCCAGACATGAGCGTAGC
AACTCTGTGGTCATTTTCTTGGAAATGAACCCTGTGCCTTCAGGGTCCAGCAGGTAGAACGACAGCATGAGTTTCTGCTCACGCGTAGCCTTCTGACTCA
GTAGCGACAGTCCCTTCATCAGATCTTCGAACGTCACCTGCACCACATTCACATAACTTCAGTATCTCTATCCTTTTAACACTATGTAACAGTTCTATAT
ATCTCCTTACATGTCCCTTCTTATCCATGTCAAAGATCGCGTAGAGGCGGTTGACATAGAGACTGGAAGAGTTGCCGTCTCCGCccgccaagaagcggaa
aaACTCATCCTTGGGGATCACTACAGCGTCGTTCTCGTGCTGACCAAGAACTGCCGCCAAGTGCTTGCGGATGGACTGCATGTCGTGCTGAGAGAAGACT
GCAGAGATATCCACATCCGCCAGTTTCGTCTCCAAAAGAGAGTGCGGAGGGGGCGGAGGAGGAGCCGAGACGCTTGATGGGGCGCTGATAGGCGCAGGGG
CTGGAGTCGAAGCCACGGGGGCAGGTGCAGACACAGGCGCAGAGGGTGGTGCGACCTCGTCGGCGCCACGGGAGCTGCGTGGGGCtgaggtggacgaggt
ggatGGTGTCGGTTTGGCCTGCTTGTTCCCCATAGTAGCTGCTGATTATGAAATGGATGTGGATTCCGTTTTGAGGGTGATGTACTGTAATGATTACAGC
AATAAATTCGAGAATATCTTTGGCTTTGTAAGTGGTACGTAATCTAATGGGATGATCATTATAATAGATCGGCAAGATGTGGTTTTTGTACCAAATATTT
GGTACGACGACCAATACTTGGTGCTGGCACAAGCGTTGAAGTCATGGTGGTGGTTCGTTCGAGCACGCGTGTGCAAGAGGAAGGGAAGGAGGCAGCGGTG
GCAATGCCTGCTGAGGTTACCGAAGCCATTGCTATGGTGCAAAGCGACTCTCCACTCGTGGCGGCTGAGGGTTTCTCCAAGCTCTCACACGCCACTTTCA
ACAACCGTAAGTTGTGACAGTTGACCCCAATTATGACACACTACTAACCCAATTGTCATCTATAGCGGTTGGTAAGGAGGCTGCTGGAGAGGCTGGCGCT
ATTAAGGCAATTGTCGAAGCCATGGAGCGCAATATCTCCAATGGAACTGTCCAGGAGGACGGCTGTCATGCACTGCGCAACGTCGCCTTCCGCTGCGGTT
AGTCGATCAGTTAGTTAATCAGAAGAGTGAAGCAGCGTAGACAGAGGCTCATCGCTCTTTATGACTGTATTTTGTGGACCTTCACTAGATCCTAATCTGG
CGCTGGCAGGGGAGCAAGGTGCGATTAATGCTGTCctgaaggcgatggaggcaCATCCGGAGAACGAAGCGCTGCAGGCGGAAGGCTGTTGGGCTCTGCT
GGTCTTTTGTTCTAACACAGGTTCGATGTAAATTGTTCGACCGGAATTGTGCGTGTTCTAAGCTCACGATGCCTGATGGCTTTACTGTGTATTAGAGGAA
AACGCCGCAGTGGCGAGAGAGCAAGCGTCTATTGTGGACAAGGCTGTCGATACGTACAAGGCAAATGCCGATATCCAGGGCCGCGGTCAATTTCTGAAGG
TGCTCTTCACAGGAGCATATGTGGGTTAGTGAAACAGGTTTAGACACAGGATTGTAACCAGAGTGACGAAAGTGCATATATAATCCTGTCTCTGCCTGCA
CTGTAATGCTTGCTAgcacagcagctcaatgGTTGGCCATGCATCCTAATTATACCTGCTGCTTGAACGACCCGTAGCCTGTAGGCGTCACGAAGAGACC
GTACTCTGGGTGTTTGTGGCGCTTGTGGATATTCTCCAACTCCACGAGACTGAGCACGCTGGAGCCAAGTCCAAGCATGCATCCCGATGCAAATGGCACC
ACGCACGCctggaaggagaagagaacCGAGAACGGGTCCATAAATTGCAGTGTCGACGACAGGAAGAGGCCGAGCATAGCCATCATGTTGAAGCCTAATG
AAAGAACACAAAGCAAACGTCAGCAGCCATTACCCAAAAGAGAATAAGAAAATACATCAGAAACGTACCAGTGACCCAAGTCTCGAGAGTGGTGAGTCGA
CATGAGAACCACTGGTGGACGACCTCCACATGCCCCAGGTACGCactcaacagcagcaagaaagATCCAGCGAAGAAAGGGACCCAGTAGCCGACAATGA
GGCTCAGTTCGTCCCGTTTGACGTCCACCACGCCAAAGTTCTCTGTGTCTGACCGTACCCAGATGTAAGCACGCGCAAAGACGTAGAGTAGCGATCCCAG
CATGCCCATGATAGCTGTCCAGTAGTCGATCCGACTAGGGAAGAAGCCCACGTACTGACGTTCCAGTACGGGTTCACTGCCGTGGAAATACTCATCCAGC
CAGATCTCCAAATTGTGGCAGCAGTTGATCACTTCCAGGTACGTGACAGCATGGTAAATGAGGAAGAAACCAGCCCCCAATAGCAGTGGCAAGTCCACCG
ACGAGTGGACCTGATTGCCTGGTTCACGAGCAGCTTTGTAGCCCCTGGCACTATGAGCCATGACCTCGCCCATGATGCccatgatgaagagcgaGAACGC
CACAATGGCACACAGGCTGGCCCAGAAGCTCAGCGAGCGGATCTTCCAGTTTTTGCCGTGCCAGGCCCGATACAACGTGGTCATCATTTTGCGATGCGCA
CGAGAAGACCAGACGATGCGCTTTTGGTCCACCGTGTAAAAGTCCACGAGCGTTGGGGAGAAGGCGTCCACTCCGTAGTAGACCGAGTTGACGCTGTCTG
GGGCCGGTACGATGAGCTCCTCGGAAGCGACGCGCGAGTAGGAAGATGACACGGACGAGGCCGTGGGGCTAGTGGCCGCGTACATACCGTGCTGAAGTAA
AGGGAATTCCTTCTTGGCGCCCATATTCATGCTGTCGTTTCTTTAGTGAGTTCCTGGGTTAGATCGCTTCGTTGGCAGCTGGCGACTGTTGAGTGTTTTG
GTTAAGTATGGGGGGGGAGCGGTTGAGATCTGACCAAAAATAGAAGATTGAGGCCAAGCGTTGGGAAACGTGAGGTTTTGGATGGCGGATATTTGATATC
GATCGCTTGAAACTGGCGGACGAGGCAAGTGACCTGCGTGCTGGCGGGAGAGATGAAGAATGGCCTGCCTAAGATATATGAGTTGGGAACGGTAGCTCGT
GGTGCCCGATTTTTGCTACTTTGCTTCAACAAGCCCTTTCCGCCAAGCGTATACTGAGTTTTGACTCGCTTTCACTATGCTGTGCGGATTTCGAATGTCG
AGCGGGAATCGAACGGCACATACGCAATTGACCTCGACTTGAGACCGTGTAGAGCGTCGTGCAATGCCTGCTTGCGCATTGAACGCTTTGCTGCCTACTT
TGGGACGGCTGGTAGGCAATCAGCAAGCGGCTGGCGGAATCGCAGGCGGCGAGGTTGGGGGGACTAGGCGTGAGTCACAAGACGCAAGGGTAAAATTATA
GTAACTTCAATGCAATGGCGTTTGATGCGTTGCGCATATGGTGTGCTTCAGCTGGGGGTGGAGGATATTCCATGCAAGACGCATCTTGGCTCAGGATCTT
TTACTGCCTCGGCAGTTGCTAATAGCAGCCTGCTAGGATAACAGCTAGCGTAGAGTTCTTACCAAAGATAATGTCCTGGAAATCTCGCTCGCTTACTACT
ACTACTCTCTAGGATCGATTAGCCTTAAGCGCTACATCTGCACAAGTCTGGTGCAGCATGTCATGCTCCTGTGCGTTATCTCTCACAAAAAATGAACAAT
TTCGGCAAAAGGCGCATATTTCGACATATTTAATTTTTTAATGGGATTTTTCAACTTTAAATTACTTTTCATATTAAATGCTAAATATGCACCTTTTGTG
CCTTTCTGACATAGCGTATACCTGATCTTTTCGACGACGTATACCAGCCTGTTTTATGACCAGAAGGCGCGGTCGAATTTCGAAATAAATACGAACGTTC
GCGGAATGAGTACATCACCCAGAACCAATCACATTCCGCCAAAAGCAATTCATCCAATTAGTGTCGCTATGTCGGTATTTGACCAATCAGACGGCTGCAT
GCGGATAGCGAATCTACGCCATGGCGACGAACCACCTGCTCGCGACGCCAGCCTTCGCGCTGCCGCTAGACTTATCcagcgacaacgacagcgacgacaa
tAAAGAGCACACTGGCGTCTACAGCTTCGGACAGGTAAGCTACAAAACAATAATACACGACAGAATCCATCTACTAGAGCTTCTGACATCACAGTCTTTC
GATGGCTTTAGAACACGTACGGAGAGCTCGCTCTAGGCGACACATTCGACCGCAACACGCCAACACGTGTGAACCTCGGCAATGGAAATGAAAacaagct
ggtggtggatgtggCCTGTGGGAATGAACAAACTGGCATTCTGTTTGGTGAGTTGCAAAGATATTGCAAAGTTTGCTAGCTGTCGGTACTGATTAATGCA
ATTGGATACATGACATGACAGCGGATGGAGACGTGTATACATGCGGTTATAATGATAGGTGCGGTCGATGTCATTTGCATATATTGGACCGTGGTTATTG
ATTTTGGTTTGTGCGTTAGTGGGCAATGTGCAGTGGGGACGACGGAGCGTGTGCCGACGCTCCGGTTCTCTCCGAGTCTCAGCTCCAAACGCAGTATTCG
AGTCTTTTCTGGGAATGGGAGCGAAcacttggcagcattgagCGGTAGAAATTTTGGATTTTTGCGCTAGTGTTACGGATGCGAGTTCTAACTACTGCCT
TTTATATTTACGGCGTTGGGTAGCAAATGGGAATCTATACACAGTCGGCTTCAACATGCGTGGCCAGCTGGGCCTTGGCTCCGCGACGACAGTGACTGAG
GCAACGCTGGTGGAAGAACTAGCAGGCAAGCGGGTGGTGGATGTGGCCTGCAGCTACTTCCATACGGCGATTATCATGGATGACGGCGAATTATATTCGT
GTGGTTGCAATGACTATGGTCAATTGGGATCAGGTGGTCACAATGGTCAGCTCATTCCACACCCTGTCGGGTATTTTTTACGTCGTCCAGTCCTCGCCGT
GGCTTGTGGCCAACATTACACAGTTGCATCCTTACGTGCGTACCTTCTTGTGAAAGCAGTGTGTCTGCATTGAGGGGCTAATCTTGTTAGCATGGTTGTT
GCAGAGGAAGGTGGGGTTGTAGCGTTTGGCAAAAATGACCATGGGCAACTAGGGATCAACAATACGTCGGAGCCAGTACTGCAGCCTACGCGACTGGCCC
CTCCGCTGGATAGGGTAGTGGTGCCGCAACTCGCTTGTGGTTACCATCACACTGCCGCTGTCACGGAGGATGGAGCTGTTTATACTTTTGGACGCAACGA
TTACGGGCAACTTGGTCTTGGACACAAACTGCATATGGTTAGGCCAATGGTGCGTCAGTTCTCGAGACTTATGATTTCCTTTTACTTTATATTTCACTAA
CGTTCAAGAGGAGTTTTGTTGTACCTGTCTGGTGATGTTATGCAGCCAGTGGATAGTTTGGCACGTATGAGGGTCACCCAGGTCGCTTGTGGGTGCTATC
ACACCCTTGCACTCTCCGACGACGGTAAGGTGTTGCCATTTGGACGCAATAACCATGGTCAGCTTGGACTGGAGACGTCGGTGGATTGCTTGAGTCCACA
GCTTATCTCTACCCTGAGAAGCAAAACCGTTATCAAGGTATGGAATATGCCGACAGGAAATCTGCTTGCACCCAAGTCTGTTTTGGATGGGAAGCTCATT
AGCATTGCCGTGGTTAATGCTCCAACAGGTCGCTGCTGGGTTCTACCATTCTGTCTGCTTGGTGGGCTCACGTGACGGCGAGACTCCACAAGCAAAAAGC
TCTGGAACACTAAGTGGCGATTTGCGCAAGATGCTCAACAACTCCACCCGAAGTGATGTCACGTTTGTTGTCGAAGGTCGTCGGCTTTTCGCACATAGTT
GCATCCTGGTAGCTCGCTGCGAGCCTCTCGAGAAAATGCTAGACGGGCGAATGAAGGACGGTTCATTATCAGAAATTGTCATCCCGGAGTATTCAGTACG
TATGTTTATACTTGTGAACTATGGTCGGCCCCGTCTTAACTAAAGTTCAATTGGGCTGGTGATCTTGCGACAGTATGATGTATTCGCAGCCTTCATGGAG
TTCCTCTACACCGATGAAGTGGCTGCCTTGGCAGCACGTGACCTGACAGCAGGTACGGTATCACAGGATCTTGAATGTCCAGTAACAGTGTATTCTGGTG
CAGATTCTCATCATCGTTTGATTTTCattcttggtggtggtgtgaATTGCGGTGTAGatcttgctcttgagctgcatgtATTGGCAGATCAATACTTGGT
TACTGCTCTTCGAAGGTACATGCCTCGCAACACTGTTATCGCATGTTCTGTTTCGCTTATCGCTTTAAGACAATTATTAATCATGCCTGTTGGGCCATGT
ACTTTGCGCAAAACAGCTCGTGTGAGAGTGCTCTGCTACGAATATTATCGGTGGATAATGTCGTTTTGGTCATGGAGGTTCGGACGCTGACGAATTTTGT
CCTTGGTTAGAGTATCGTAGACTTACTAACCTTCTGTTGTGCATCAAATGGCTCATTGCATGGTACAGTCTGCGCACTTCCGCGATGCTTATGCACTCAA
GAAACGTTCCCTCCGTTTTATCCTAGACCACTTCGCTCGTGTTATAGCTACAAAGGTGCGAGTAGCTCCCATTTTCACCTACGTTCGGCAACTCCTGTCT
AATTGATGCTGAATGTCTGTTGTTGACCGTGGAAATGCGTGGCTAGGCTTTTATCGAGCTGCCACAAGAAATTCTCCAGGAGGTGTTGCTCTTGGCTTCT
CAACAAGGAGTCGCAGTTCCTAATCAAACCAATGCTAACGGTGGCACTTACAGCGAGAATCTTCGCGGACGCTGAGCCACCTGTACTACATTTATGTTAA
AATTCGAGTGCACGCTATTAGTACTTGTATATCTACTACTACGTAGGAGGCACATCCATGGGGAAAAACTTATTGACGCCAAACAGAGGTTAGATTGCAG
CGCGCTACTGCTATCCTCGTGAACTTTTTACTGTGCTTGTAAAGCTGTGCACTacatgctgttgctgttctATTCATCCTGGTTGCTCAACTCATTTCTG
TCAGCATACTCACAGGTGTCTCTAAGTATCCCTTCCATTGGTTCGAGAAGCGCGCCATTGTCGCGCCATCAATCACACGGTGATCACCACTCCACGATAC
GTTCATTAAGCGCATAGGCTCAACATTACCCTCTGCGTCGTAACGAGGTAATTTCTGGATTTGTCCAATTGCTCCGATGGCGACCTGGGGAACCAGGAGG
ACGGGGCTCATGTACGTGCCACCAATACTGCCGATATTGGAGATTCTGTACAAAATTGCCACAAAGCCATAAGACAATTGCGATAAATCAGACAAAAACA
CATCGCCAACTACGTACGAGAATGTGCCTCCCATCAGATCGTTAGGGCCGAGTTTGCCATCAGTAGCGAGCTGTTGGAGACGATTAAGATCCTCAGCAAT
CTGCAAAATGCTCTTTGCCTATTTAGCGCACAAATGTGAATGAGCTTAGAACGCAAAGTTTGTAGCTATCAAAAGTGCACATACCTGAACATTCTTGACA
TTCGGCACGATCAAGCCTGTGGGTGTGTCCATTGCAACAGAAATGTTGTGTGCAGCAACCATTGTGACTTCTGTCTCGCTGTCGTTTACGGTCGCGTTCA
GCATGGGGTATTCCTTGAGAGCCAACGAAGCAGCTTTGATGATGAAAGGCATGAACGAAAGCTTCACACCACGAGACTCAGCGAGAGGCTTCAGCTCATT
GCGAAGATTGTACAGTGCGTCCATTCGAATCTGCGTTAATACAAAAGGAAACAACGTTAGCATCCCCACAGATGACAGTATTAAACTACTACATTACCTC
ATCCGCGTAACCAAAATGCGGGACCTGGAGCGCCGCGTTCATCGATTTGACCATCATCTTCTGAATAGCTACATCCAGAAAAAACATGCACATCAGTTAA
AAGGGACGTCACGCAAAAGTTTAACTGCAGTAGTCACGTACGAGTAAGAGGCACCACCGTGTCTTGCTGCAGATACGTTGCTCGGGGCACATCAGTCGGC
GATGTAACCTTGACAGTAGCAATCTGAGCCTTAGATTCAGTCGGTGAAGGCTGTTTGGACAGCATTTTGATGTACTCCAACAAGTCTTCCTTCAGAATTC
GCCCTTGGGGACCCGAGCCTTCCACAGCATACAGATCAATACTGTGCTCTCGTGCAAGCCGACGCACCGACGGAGACGTCAACAGCTACAAAACACCAGC
CACACCATCAATCTCAACTGCACTTTAAAATCCCTAAAACCCACAACTCACCTTCTCATCATTCTCGTGTCTACGAGGTGCAACTGGCGTTGGAGTCGGT
ACTGGTGTCGGGACCACCGGCACAACCACCGGTGCAGTCACAGGCTCTTTCTCCACCGCAGCAGCTGGCGTGGGGGCTTTGCGGGATACCGGAGGTCCCG
CCTTCTTTTTTCCAGAACTTTGGACTGATGCAGCGGTCGCTTCGTCCACGTCGATGTCGATGAGCGTGGAGCCCACTTGAGCCATCTCACCCACCTCGTA
GTGCACTTTCGTGACGATTCCGTCATACCGACTGGTGATCTCCACTGTGGCCTTGTCACTCTGCACCTCGCACACATTCTGGAACTGTTTGACCTCGTCG
CCACTCTTGACGAACCATTGCAAAACTTCCACCTCGGCGATCCCTTCGCCGATATCTGCAAGTTTGAATGGGACTTCAGGGAAACAGTTGAATGGTCCAG
CGTGAAAGCGACGTAAAGTTCGTTGTGCATTGGCACGGATGTGACGTGTGATCAGGATCGACGTCATGGCGACGGCTCGAATTCGGGAATGAGCTCGAAA
GCGACTGACGGTCCAAAAATGCTGCTTCGATTGGACCAAGTGCAATGATAGGGCTAGGTAATTCTGATTCTAATAGTTAGGTGGACCACTAAATAATATC
GGAGGAGAGACGACATCTCATTTTCTAAGCTCAGGTTCGTCATCTTTGAGCTGTACATgcagttgaagtgctttACTATAAGAGTTTGACACATAGAAAA
CCAAGACTTTGACTCTGTAGCTCATTTCACAATTCGTTTAGTCCTTGACACTCAATTAATTGATGACGTTCCCGAACGATTCACTGTACCTGGGTCTGGA
TTGCTCGACTCAGAGCATGTCTGCTGTAgtggtggatgctggtggCCACGTGGTGTACGAAAGCTCCTTCCGCTTCGACGAACGCTTCCCGAAGTACGGA
ACTGACAACGGAGTGCTACGTGTGAAGACTAATGAGGTCGTGATCCCATCGCTCATGTTTGTCGAGTCACTGGACGCTATTTTGGAAGACCTGACCCAGA
GCTCTGTAGATGTGACCAAGATCAAAAGTGTCAGCGGGAGTGCTCAGCAGCATGCATCAGTGTACTGGAGCAAGGGGTTCTCACTCCGCAAATGTCTGGT
GGACGCTGAGGCTGgcgcctcctccatcgtggAGGCCATGGCCAAGCAACAGGAGACCGCCTTCTGTTTACCCAACGGACCGAGCTGGATGGACAGCTCT
ACGACCCGCTATTGCACAGAACTGGAGGCAGCGGTCGGCGGTGCTGACCGCGTCGCGGAGATCAGTGGATCTCGAGCGTACGAACGCTTTACCGGTAATC
AGATTGCCAAGCGGATCCACCAAGACCCTGCGTTCCTGGAGAAATGTGGACGTATCGCACTGGTTTCGTCGATGctgacatcgctgctgtGTGGCGATTA
CACTCCTATCGATGACAGTGATGGTTCTGGTATGAACTTGTTGGATGTACGTGAGAGAGTGTGGTCGTCCGAATTTGTGAAGGCGACGGTAAAGCATAGC
AGTTCTGTCGATGCACC